Molecule Information
General Information of the Molecule (ID: Mol01582)
| Name |
hsa-miR-205-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 205
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UCCUUCAUUCCACCGGAGUCUG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [1] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | ABCC2 was a downstream target of miR205-5p, overexpression of miR205-5p suppressed the expression of ABCC2 in k562-R cells. SNHG5 promotes imatinib resistance through upregulating ABCC2. SNHG5 promotes imatinib resistance in CML via acting as a competing endogenous RNA against miR205-5p. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] | [2] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Experiment for Molecule Alteration |
Microarray analyses; Luciferase reporter assay; Western blot | |||
| Experiment for Drug Resistance |
Cell proliferation assays; MTT assay | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
