Molecule Information
General Information of the Molecule (ID: Mol01582)
Name |
hsa-miR-205-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 205
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UCCUUCAUUCCACCGGAGUCUG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Chronic myeloid leukemia | [1] | |||
Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
Resistant Drug | Imatinib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | ABCC2 was a downstream target of miR205-5p, overexpression of miR205-5p suppressed the expression of ABCC2 in k562-R cells. SNHG5 promotes imatinib resistance through upregulating ABCC2. SNHG5 promotes imatinib resistance in CML via acting as a competing endogenous RNA against miR205-5p. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.