Molecule Information

General Information of the Molecule (ID: Mol01580)

• Name: hsa-miR-199b-5p ,Homo sapiens
• Synonyms: microRNA 199b
• Molecule Type: Mature miRNA
• Sequence: CCCAGUGUUUAGACUAUCUGUUC
• Ensembl ID: ENSG00000207581
• HGNC ID: HGNC:31573
• Mature Accession: MIMAT0000263

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: JAG1/Notch1 signaling pathway; Activation; hsa04330
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780CP cells; Ovary; Homo sapiens (Human); CVCL_0135
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• In Vitro Model: A2780s cells; Ovary; Homo sapiens (Human); CVCL_4863
• In Vitro Model: C13 cells; Ovary; Homo sapiens (Human); CVCL_0114
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vitro Model: ES-2 cells; Ovary; Homo sapiens (Human); CVCL_3509
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: XTT assay
• Mechanism Description: The forced expression of miR-199b-5p could suppress ovarian cancer cell growth and sensitize the cells to cisplatin-induced cytotoxicity. On the other hand, as a direct target of miR-199b-5p in ovarian cancer cells, JAG1 depletion by siRNAs also resulted in cell growth retardation and sensitization to cisplatin-induced cytotoxicity. In contrast, activating Notch1 signaling by JAG1 or repressing miR-199b-5p by anti-miR-199b-5p could induce the activity of JAG1-Notch1 signaling in ovarian cancer cells. The loss of miR-199b-5p increased the activation of JAG1-Notch1 signaling, which in turn promoted ovarian cancer progression and acquired chemoresistance.

Imatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [2]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: Wnt2-mediated Beta-catenin signaling pathway; Inhibition; hsa04310
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: Ku812 cells; Bone marrow; Homo sapiens (Human); CVCL_0379
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-199a/b-5p enhance imatinib efficacy via repressing WNT2 signaling-mediated protective autophagy in imatinib-resistant chronic myeloid leukemia cells.

References

• Ref 1: Epigenetic silencing of microRNA-199b-5p is associated with acquired chemoresistance via activation of JAG1-Notch1 signaling in ovarian cancer. Oncotarget. 2014 Feb 28;5(4):944-58. doi: 10.18632/oncotarget.1458.
• Ref 2: microRNA-199a/b-5p enhance imatinib efficacy via repressing WNT2 signaling-mediated protective autophagy in imatinib-resistant chronic myeloid leukemia cells. Chem Biol Interact. 2018 Aug 1;291:144-151. doi: 10.1016/j.cbi.2018.06.006. Epub 2018 Jun 8.