General Information of the Molecule (ID: Mol01575)
Name
hsa-miR-181a-5p ,Homo sapiens
Synonyms
microRNA 181a-2
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AACAUUCAACGCUGUCGGUGAGU
    Click to Show/Hide
Ensembl ID
ENSG00000207595
HGNC ID
HGNC:31549
Mature Accession
MIMAT0000256
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [1]
Resistant Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
PI3K/AKT signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Transwell assay
Mechanism Description Paclitaxel- and cisplatin-resistant A549 cells acquired metastatic properties and EMT phenotype and had reduced PTEN expression as compared to sensitive cells. miR 181a was identified as a differentially expressed miRNA in drug-resistant A549 cells, and miR-181a mimic and inhibitor were shown to affect migration, invasion, morphology and expression of EMT-associated genes. PTEN was identified as a direct target of miR-181a. Our findings demonstrate that miR-181a expression in lung adenocarcinoma is associated with EMT progression, potentially through targeting of PTEN. Regulation of miR-181a may provide a novel strategy for overcoming resistance to paclitaxel and cisplatin in lung adenocarcinoma.
References
Ref 1 MicroRNA-181a regulates epithelial-mesenchymal transition by targeting PTEN in drug-resistant lung adenocarcinoma cells. Int J Oncol. 2015 Oct;47(4):1379-92. doi: 10.3892/ijo.2015.3144. Epub 2015 Aug 31.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.