Molecule Information

General Information of the Molecule (ID: Mol01575)

• Name: hsa-miR-181a-5p ,Homo sapiens
• Synonyms: microRNA 181a-2
• Molecule Type: Mature miRNA
• Sequence: AACAUUCAACGCUGUCGGUGAGU
• Ensembl ID: ENSG00000207595
• HGNC ID: HGNC:31549
• Mature Accession: MIMAT0000256

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [1]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Transwell assay
• Mechanism Description: Paclitaxel- and cisplatin-resistant A549 cells acquired metastatic properties and EMT phenotype and had reduced PTEN expression as compared to sensitive cells. miR 181a was identified as a differentially expressed miRNA in drug-resistant A549 cells, and miR-181a mimic and inhibitor were shown to affect migration, invasion, morphology and expression of EMT-associated genes. PTEN was identified as a direct target of miR-181a. Our findings demonstrate that miR-181a expression in lung adenocarcinoma is associated with EMT progression, potentially through targeting of PTEN. Regulation of miR-181a may provide a novel strategy for overcoming resistance to paclitaxel and cisplatin in lung adenocarcinoma.

References

• Ref 1: MicroRNA-181a regulates epithelial-mesenchymal transition by targeting PTEN in drug-resistant lung adenocarcinoma cells. Int J Oncol. 2015 Oct;47(4):1379-92. doi: 10.3892/ijo.2015.3144. Epub 2015 Aug 31.