Molecule Information

General Information of the Molecule (ID: Mol01575)

• Name: hsa-miR-181a-5p ,Homo sapiens
• Synonyms: microRNA 181a-2
• Molecule Type: Mature miRNA
• Sequence: AACAUUCAACGCUGUCGGUGAGU
• Ensembl ID: ENSG00000207595
• HGNC ID: HGNC:31549
• Mature Accession: MIMAT0000256

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] [1]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OE19 cells; Esophagus; Homo sapiens (Human); CVCL_1622
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: MiRNA microarray analyses, qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [3]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Transwell assay
• Mechanism Description: Paclitaxel- and cisplatin-resistant A549 cells acquired metastatic properties and EMT phenotype and had reduced PTEN expression as compared to sensitive cells. miR 181a was identified as a differentially expressed miRNA in drug-resistant A549 cells, and miR-181a mimic and inhibitor were shown to affect migration, invasion, morphology and expression of EMT-associated genes. PTEN was identified as a direct target of miR-181a. Our findings demonstrate that miR-181a expression in lung adenocarcinoma is associated with EMT progression, potentially through targeting of PTEN. Regulation of miR-181a may provide a novel strategy for overcoming resistance to paclitaxel and cisplatin in lung adenocarcinoma.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: MiRNA microarray analyses, qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.

References

• Ref 1: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
• Ref 2: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 3: MicroRNA-181a regulates epithelial-mesenchymal transition by targeting PTEN in drug-resistant lung adenocarcinoma cells. Int J Oncol. 2015 Oct;47(4):1379-92. doi: 10.3892/ijo.2015.3144. Epub 2015 Aug 31.