Molecule Information
General Information of the Molecule (ID: Mol01575)
Name |
hsa-miR-181a-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 181a-2
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AACAUUCAACGCUGUCGGUGAGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung adenocarcinoma | [1] | |||
Resistant Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
PI3K/AKT signaling pathway | Regulation | hsa04151 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Transwell assay | |||
Mechanism Description | Paclitaxel- and cisplatin-resistant A549 cells acquired metastatic properties and EMT phenotype and had reduced PTEN expression as compared to sensitive cells. miR 181a was identified as a differentially expressed miRNA in drug-resistant A549 cells, and miR-181a mimic and inhibitor were shown to affect migration, invasion, morphology and expression of EMT-associated genes. PTEN was identified as a direct target of miR-181a. Our findings demonstrate that miR-181a expression in lung adenocarcinoma is associated with EMT progression, potentially through targeting of PTEN. Regulation of miR-181a may provide a novel strategy for overcoming resistance to paclitaxel and cisplatin in lung adenocarcinoma. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.