Molecule Information

General Information of the Molecule (ID: Mol01570)

• Name: hsa-miR-30c-5p ,Homo sapiens
• Synonyms: microRNA 30c-2
• Molecule Type: Mature miRNA
• Sequence: UGUAAACAUCCUACACUCUCAGC
• Ensembl ID: ENSG00000199094
• HGNC ID: HGNC:31627
• Mature Accession: MIMAT0000244

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: HO8910 cells; Ovary; Homo sapiens (Human); CVCL_6868
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• In Vitro Model: ES2 cells; Ovary; Homo sapiens (Human); CVCL_AX39
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR30a/c-5p in turn directly inhibited DNMT1 as well as Snail. Forced expression of miR30a/c-5p or knocking down of DNMT1 and Snail promoted cisplatin susceptibility and partially reversed epithelial-mesenchymal transition (EMT) in CP70 cells.

References

• Ref 1: A Feedback Loop Between miR-30a/c-5p and DNMT1 Mediates Cisplatin Resistance in Ovarian Cancer Cells. Cell Physiol Biochem. 2017;41(3):973-986. doi: 10.1159/000460618. Epub 2017 Feb 21.