Molecule Information
General Information of the Molecule (ID: Mol01570)
| Name |
hsa-miR-30c-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 30c-2
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGUAAACAUCCUACACUCUCAGC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [1] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| HO8910 cells | Ovary | Homo sapiens (Human) | CVCL_6868 | |
| CAOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0201 | |
| ES2 cells | Ovary | Homo sapiens (Human) | CVCL_AX39 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis | |||
| Mechanism Description | miR30a/c-5p in turn directly inhibited DNMT1 as well as Snail. Forced expression of miR30a/c-5p or knocking down of DNMT1 and Snail promoted cisplatin susceptibility and partially reversed epithelial-mesenchymal transition (EMT) in CP70 cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
