Molecule Information
General Information of the Molecule (ID: Mol01565)
| Name |
hsa-miR-198
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 198
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
GGUCCAGAGGGGAGAUAGGUUC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | PI3K/AKT signaling pathway | Activation | hsa04151 | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| BGC823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; Dual-luciferase reporter assay | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Circular RNA AkT3 upregulates PIk3R1 to enhance cisplatin resistance in gastric cancer via miR-198 suppression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [2] | |||
| Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 | |
| A172 cells | Brain | Homo sapiens (Human) | CVCL_0131 | |
| T98 cells | Brain | Homo sapiens (Human) | CVCL_B368 | |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| U118 cells | Brain | Homo sapiens (Human) | CVCL_0633 | |
| U138 cells | Brain | Homo sapiens (Human) | CVCL_0020 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay | |||
| Mechanism Description | miR-198 enhances temozolomide sensitivity in glioblastoma by targeting MGMT. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
