Molecule Information
General Information of the Molecule (ID: Mol01565)
Name |
hsa-miR-198
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 198
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
GGUCCAGAGGGGAGAUAGGUUC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | PI3K/AKT signaling pathway | Activation | hsa04151 | |
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
BGC823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR; Dual-luciferase reporter assay | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Circular RNA AkT3 upregulates PIk3R1 to enhance cisplatin resistance in gastric cancer via miR-198 suppression. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [2] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 | |
A172 cells | Brain | Homo sapiens (Human) | CVCL_0131 | |
T98 cells | Brain | Homo sapiens (Human) | CVCL_B368 | |
U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
U118 cells | Brain | Homo sapiens (Human) | CVCL_0633 | |
U138 cells | Brain | Homo sapiens (Human) | CVCL_0020 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Colony formation assay | |||
Mechanism Description | miR-198 enhances temozolomide sensitivity in glioblastoma by targeting MGMT. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.