Molecule Information

General Information of the Molecule (ID: Mol01561)

• Name: hsa-miR-29b-3p ,Homo sapiens
• Synonyms: microRNA 29b-1
• Molecule Type: Mature miRNA
• Sequence: UAGCACCAUUUGAAAUCAGUGUU
• Ensembl ID: ENSG00000283797
• HGNC ID: HGNC:31619
• Mature Accession: MIMAT0000100

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Bortezomib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Multiple myeloma [1]

• Resistant Disease: Multiple myeloma [ICD-11: 2A83.0]
• Resistant Drug: Bortezomib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: 8226 cells; Bone marrow; Homo sapiens (Human); CVCL_0014
• In Vitro Model: NCI-H929 cells; Bone marrow; Homo sapiens (Human); CVCL_1600
• In Vitro Model: U266 cells; Bone marrow; Homo sapiens (Human); CVCL_0566
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: LncRNA H19 overexpression induces bortezomib resistance in multiple myeloma by targeting MCL-1 via downregulating miR-29b-3p.

References

• Ref 1: LncRNA H19 overexpression induces bortezomib resistance in multiple myeloma by targeting MCL-1 via miR-29b-3p. Cell Death Dis. 2019 Feb 6;10(2):106. doi: 10.1038/s41419-018-1219-0.