Molecule Information
General Information of the Molecule (ID: Mol01559)
Name |
hsa-miR-100-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 100
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AACCCGUAGAUCCGAACUUGUG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [1] | |||
Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis | |||
Mechanism Description | Cisplatin-resistant lung cancer cell-derived exosomes increase cisplatin resistance of recipient cells in exosomal miR100-5p-dependent manner, and mTOR acts as a target gene of miR100-5p. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Eml4-alk positive non-small cell lung cancer | [2] | |||
Resistant Disease | Eml4-alk positive non-small cell lung cancer [ICD-11: 2C25.8] | |||
Resistant Drug | Crizotinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
mTOR signaling pathway | Inhibition | hsa04150 | ||
In Vitro Model | DFCI032 cells | Lung | Homo sapiens (Human) | CVCL_A763 |
NCI-H2228 cells | Lung | Homo sapiens (Human) | CVCL_1543 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Cell viability assay; Toxilight cytotoxicity assay | |||
Mechanism Description | miR-100-5p confers resistance to ALk tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALk positive NSCLC. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Eml4-alk positive non-small cell lung cancer | [2] | |||
Resistant Disease | Eml4-alk positive non-small cell lung cancer [ICD-11: 2C25.8] | |||
Resistant Drug | Lorlatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
mTOR signaling pathway | Inhibition | hsa04150 | ||
In Vitro Model | DFCI032 cells | Lung | Homo sapiens (Human) | CVCL_A763 |
NCI-H2228 cells | Lung | Homo sapiens (Human) | CVCL_1543 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Cell viability assay; Toxilight cytotoxicity assay | |||
Mechanism Description | miR-100-5p confers resistance to ALk tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALk positive NSCLC. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.