General Information of the Molecule (ID: Mol01559)
Name
hsa-miR-100-5p ,Homo sapiens
Synonyms
microRNA 100
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AACCCGUAGAUCCGAACUUGUG
    Click to Show/Hide
Ensembl ID
ENSG00000207994
HGNC ID
HGNC:31487
Mature Accession
MIMAT0000098
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung cancer [1]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis
Mechanism Description Cisplatin-resistant lung cancer cell-derived exosomes increase cisplatin resistance of recipient cells in exosomal miR100-5p-dependent manner, and mTOR acts as a target gene of miR100-5p.
Crizotinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Eml4-alk positive non-small cell lung cancer [2]
Resistant Disease Eml4-alk positive non-small cell lung cancer [ICD-11: 2C25.8]
Resistant Drug Crizotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
mTOR signaling pathway Inhibition hsa04150
In Vitro Model DFCI032 cells Lung Homo sapiens (Human) CVCL_A763
NCI-H2228 cells Lung Homo sapiens (Human) CVCL_1543
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Cell viability assay; Toxilight cytotoxicity assay
Mechanism Description miR-100-5p confers resistance to ALk tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALk positive NSCLC.
Lorlatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Eml4-alk positive non-small cell lung cancer [2]
Resistant Disease Eml4-alk positive non-small cell lung cancer [ICD-11: 2C25.8]
Resistant Drug Lorlatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
mTOR signaling pathway Inhibition hsa04150
In Vitro Model DFCI032 cells Lung Homo sapiens (Human) CVCL_A763
NCI-H2228 cells Lung Homo sapiens (Human) CVCL_1543
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Cell viability assay; Toxilight cytotoxicity assay
Mechanism Description miR-100-5p confers resistance to ALk tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALk positive NSCLC.
References
Ref 1 Cisplatin-resistant lung cancer cell-derived exosomes increase cisplatin resistance of recipient cells in exosomal miR-100-5p-dependent manner. Int J Nanomedicine. 2017 May 15;12:3721-3733. doi: 10.2147/IJN.S131516. eCollection 2017.
Ref 2 miR-100-5p confers resistance to ALK tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALK positive NSCLC. Biochem Biophys Res Commun. 2019 Apr 2;511(2):260-265. doi: 10.1016/j.bbrc.2019.02.016. Epub 2019 Feb 18.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.