Molecule Information

General Information of the Molecule (ID: Mol01559)

• Name: hsa-miR-100-5p ,Homo sapiens
• Synonyms: microRNA 100
• Molecule Type: Mature miRNA
• Sequence: AACCCGUAGAUCCGAACUUGUG
• Ensembl ID: ENSG00000207994
• HGNC ID: HGNC:31487
• Mature Accession: MIMAT0000098

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung cancer [1]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: Cisplatin-resistant lung cancer cell-derived exosomes increase cisplatin resistance of recipient cells in exosomal miR100-5p-dependent manner, and mTOR acts as a target gene of miR100-5p.

Crizotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Eml4-alk positive non-small cell lung cancer [2]

• Resistant Disease: Eml4-alk positive non-small cell lung cancer [ICD-11: 2C25.8]
• Resistant Drug: Crizotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: mTOR signaling pathway; Inhibition; hsa04150
• In Vitro Model: DFCI032 cells; Lung; Homo sapiens (Human); CVCL_A763
• In Vitro Model: NCI-H2228 cells; Lung; Homo sapiens (Human); CVCL_1543
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell viability assay; Toxilight cytotoxicity assay
• Mechanism Description: miR-100-5p confers resistance to ALk tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALk positive NSCLC.

Lorlatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Eml4-alk positive non-small cell lung cancer [2]

• Resistant Disease: Eml4-alk positive non-small cell lung cancer [ICD-11: 2C25.8]
• Resistant Drug: Lorlatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: mTOR signaling pathway; Inhibition; hsa04150
• In Vitro Model: DFCI032 cells; Lung; Homo sapiens (Human); CVCL_A763
• In Vitro Model: NCI-H2228 cells; Lung; Homo sapiens (Human); CVCL_1543
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell viability assay; Toxilight cytotoxicity assay
• Mechanism Description: miR-100-5p confers resistance to ALk tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALk positive NSCLC.

References

• Ref 1: Cisplatin-resistant lung cancer cell-derived exosomes increase cisplatin resistance of recipient cells in exosomal miR-100-5p-dependent manner. Int J Nanomedicine. 2017 May 15;12:3721-3733. doi: 10.2147/IJN.S131516. eCollection 2017.
• Ref 2: miR-100-5p confers resistance to ALK tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALK positive NSCLC. Biochem Biophys Res Commun. 2019 Apr 2;511(2):260-265. doi: 10.1016/j.bbrc.2019.02.016. Epub 2019 Feb 18.