Molecule Information

General Information of the Molecule (ID: Mol01557)

• Name: hsa-miR-98-5p ,Homo sapiens
• Synonyms: microRNA 98
• Molecule Type: Mature miRNA
• Sequence: UGAGGUAGUAAGUUGUAUUGUU
• Ensembl ID: ENSG00000271886
• HGNC ID: HGNC:31649
• Mature Accession: MIMAT0000096

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Ubiquitin-proteasome signaling pathway; Regulation; hsa05017
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: A459 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: NEAT1 may act as a competing endogenous LncRNA to upregulate EGCG-induced CTR1 by sponging hsa-mir-98-5p to upregulates EGCG-induced CTR1 to enhance cisplatin sensitivity in lung cancer cells.

References

• Ref 1: NEAT1 upregulates EGCG-induced CTR1 to enhance cisplatin sensitivity in lung cancer cells. Oncotarget. 2016 Jul 12;7(28):43337-43351. doi: 10.18632/oncotarget.9712.