Molecule Information

General Information of the Molecule (ID: Mol01552)

• Name: hsa-miR-29a-3p ,Homo sapiens
• Synonyms: microRNA 29a
• Molecule Type: Mature miRNA
• Sequence: UAGCACCAUCUGAAAUCGGUUA
• Ensembl ID: ENSG00000284032
• HGNC ID: HGNC:31616
• Mature Accession: MIMAT0000086

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: This gene is down-regulated in cisplatin-resistance cells

Dasatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [2]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Dasatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Lin-CD34+CD38- cells; Bone; Homo sapiens (Human); N.A.
• In Vitro Model: Lin-CD34-CD38- CML cells; Bone; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Annexin V assay
• Mechanism Description: The up-regulation of miR29a-3p observed in CML LSCs led to the down-regulation of its target TET2 and conferred TkI-resistance to CML LSCs in vitro.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [3]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT pathway; Regulation; N.A.
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Here, the functional effects of miR-29a in chemo-resistant colon cancer cells is scrutinized. The effect of doxorubicin (DOX) on cell proliferation after miR-29a transfection has been evaluated using MTT assay in HT29 and HT29/DOX cells. Rhodamine123 (Rh123) assay is used to identify the activity of common drug efflux through membrane transporters P-glycoprotein (P-gp). P-gp and PTEN mRNA/protein expression levels were measured by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and Western blot analyses. Flow cytometry was employed to the investigation of apoptosis. ANOVA followed by Bonferroni's and Sidak's tests were used to compare the data from different groups. Thus, it was shown that miRNA-29a overexpression considerably inhibited the HT29/DOX viability. miR-29a significantly down-regulated P-gp expression and activity in HT29/DOX cells and declined drug resistance through elevation of intracellular DOX. Furthermore, upon miRNA-29a transfection, PTEN expression could be restored in resistant cells. These results have indicated that miR-29a target PTEN ultimately P-gp, which is downstream of PTEN, inhibit drug resistance, proliferation, and apoptosis through PI3K/Akt pathway. As a result, miR-29a overexpression is led to enhance the sensitivity of HT29/DOX cells to DOX-treatment by targeting P-gp. MiR-29a might proffer a novel promising candidate for colon cancer therapeutics during chemotherapy.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [3]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Pancreatic ductal adenocarcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: We also identified miR-29a-3p, miR-29b-3p, and miR-7-5p as downregulated miRNAs in PDAC tissues as compared with normal tissues but not with pancreatitis tissues. Conclusions: We identified a panel of miRNAs that could represent putative therapeutic targets for the development of new miRNA-based therapies for PDAC.The insulin-like growth factor-1 receptor (IGF-1R) signaling pathway is considered to be a contributing factor to the progression, metastasis, and therapy resistance of PDAC.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [2]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Lin-CD34+CD38- cells; Bone; Homo sapiens (Human); N.A.
• In Vitro Model: Lin-CD34-CD38- CML cells; Bone; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Annexin V assay
• Mechanism Description: The up-regulation of miR29a-3p observed in CML LSCs led to the down-regulation of its target TET2 and conferred TkI-resistance to CML LSCs in vitro.

Ponatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [2]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Ponatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Lin-CD34+CD38- cells; Bone; Homo sapiens (Human); N.A.
• In Vitro Model: Lin-CD34-CD38- CML cells; Bone; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Annexin V assay
• Mechanism Description: The up-regulation of miR29a-3p observed in CML LSCs led to the down-regulation of its target TET2 and conferred TkI-resistance to CML LSCs in vitro.

Approved 1 drug(s) in total

Imatinib Mesylate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [4]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib Mesylate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Lin-CD34+CD38- cells; Bone; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry analysis
• Mechanism Description: In particular, the up-regulation of miR-29a-3p and miR-660-5p observed in CML LSCs, led to the down-regulation of their respective targets TET2 and EPAS1 and conferred TKI-resistance to CML LSCs in vitro.

References

• Ref 1: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.
• Ref 2: Deregulated expression of miR-29a-3p, miR-494-3p and miR-660-5p affects sensitivity to tyrosine kinase inhibitors in CML leukemic stem cells. Oncotarget. 2017 Jul 25;8(30):49451-49469. doi: 10.18632/oncotarget.17706.
• Ref 3: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 4: APC Mutations as a Potential Biomarker for Sensitivity to Tankyrase Inhibitors in Colorectal CancerMol Cancer Ther. 2017 Apr;16(4):752-762. doi: 10.1158/1535-7163.MCT-16-0578. Epub 2017 Feb 8.