General Information of the Molecule (ID: Mol01547)
Name
hsa-miR-19b-3p ,Homo sapiens
Synonyms
microRNA 19b-1
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGUGCAAAUCCAUGCAAAACUGA
    Click to Show/Hide
Ensembl ID
ENSG00000284375
HGNC ID
HGNC:31575
Mature Accession
MIMAT0000074
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
DLD1 cells Colon Homo sapiens (Human) CVCL_0248
SW620 cells Colon Homo sapiens (Human) CVCL_0547
CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
RkO cells Colon Homo sapiens (Human) CVCL_0504
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
NCM460 cells Colon Homo sapiens (Human) CVCL_0460
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Annexin V-PE and 7-AAD double staining method to examine cell viabilityNA; CCK8 assay; Flow cytometric analysis
Mechanism Description miR19b-3p promotes colon cancer proliferation and oxaliplatin-based chemoresistance by targeting SMAD4.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Saracatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Saracatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell viability Inhibition hsa05200
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
BT474 cells Breast Homo sapiens (Human) CVCL_0179
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Transwell assay; Flow cytometry assay
Mechanism Description miR-19b-3p increases saracatinib sensitivity by inhibiting the PI3k/Akt pathway and miR-19b-3p directly bound to the 3'-UTR of PIk3CA and inhibited PIk3CA expression.
References
Ref 1 miR-19b-3p promotes colon cancer proliferation and oxaliplatin-based chemoresistance by targeting SMAD4: validation by bioinformatics and experimental analyses. J Exp Clin Cancer Res. 2017 Sep 22;36(1):131. doi: 10.1186/s13046-017-0602-5.
Ref 2 miR-19b-3p inhibits breast cancer cell proliferation and reverses saracatinib-resistance by regulating PI3K/Akt pathway. Arch Biochem Biophys. 2018 May 1;645:54-60. doi: 10.1016/j.abb.2018.03.015. Epub 2018 Mar 14.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.