Molecule Information

General Information of the Molecule (ID: Mol01547)

• Name: hsa-miR-19b-3p ,Homo sapiens
• Synonyms: microRNA 19b-1
• Molecule Type: Mature miRNA
• Sequence: UGUGCAAAUCCAUGCAAAACUGA
• Ensembl ID: ENSG00000284375
• HGNC ID: HGNC:31575
• Mature Accession: MIMAT0000074

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: NCM460 cells; Colon; Homo sapiens (Human); CVCL_0460
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Annexin V-PE and 7-AAD double staining method to examine cell viabilityNA; CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR19b-3p promotes colon cancer proliferation and oxaliplatin-based chemoresistance by targeting SMAD4.

Clinical Trial Drug(s) 1 drug(s) in total

Saracatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Saracatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Transwell assay; Flow cytometry assay
• Mechanism Description: miR-19b-3p increases saracatinib sensitivity by inhibiting the PI3k/Akt pathway and miR-19b-3p directly bound to the 3'-UTR of PIk3CA and inhibited PIk3CA expression.

References

• Ref 1: miR-19b-3p promotes colon cancer proliferation and oxaliplatin-based chemoresistance by targeting SMAD4: validation by bioinformatics and experimental analyses. J Exp Clin Cancer Res. 2017 Sep 22;36(1):131. doi: 10.1186/s13046-017-0602-5.
• Ref 2: miR-19b-3p inhibits breast cancer cell proliferation and reverses saracatinib-resistance by regulating PI3K/Akt pathway. Arch Biochem Biophys. 2018 May 1;645:54-60. doi: 10.1016/j.abb.2018.03.015. Epub 2018 Mar 14.