Molecule Information
General Information of the Molecule (ID: Mol01546)
| Name |
hsa-miR-19a-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 19a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGUGCAAAUCUAUGCAAAACUGA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell colony | Activation | hsa05200 | ||
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| PTEN/AKT signaling pathway | Inhibition | hsa05235 | ||
| In Vitro Model | BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| PLC/PRF/5 cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-19a-3p induces sorafenib resistance through downregulation of PTEN expression. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
