General Information of the Molecule (ID: Mol01546)
Name
hsa-miR-19a-3p ,Homo sapiens
Synonyms
microRNA 19a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGUGCAAAUCUAUGCAAAACUGA
    Click to Show/Hide
Ensembl ID
ENSG00000284204
HGNC ID
HGNC:31574
Mature Accession
MIMAT0000073
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell colony Activation hsa05200
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
PTEN/AKT signaling pathway Inhibition hsa05235
In Vitro Model BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
PLC/PRF/5 cells Liver Homo sapiens (Human) CVCL_0485
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-19a-3p induces sorafenib resistance through downregulation of PTEN expression.
References
Ref 1 microRNA-19a-3p promotes tumor metastasis and chemoresistance through the PTEN/Akt pathway in hepatocellular carcinoma. Biomed Pharmacother. 2018 Sep;105:1147-1154. doi: 10.1016/j.biopha.2018.06.097. Epub 2018 Jun 21.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.