Molecule Information

General Information of the Molecule (ID: Mol01542)

Name	hsa-mir-1915 ,Homo sapiens
Synonyms	microRNA 1915 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR1915
Gene ID	100302129
Location	chr10:21496562-21496641[-]
Sequence	UGAGAGGCCGCACCUUGCCUUGCUGCCCGGGCCGUGCACCCGUGGGCCCCAGGGCGACGC GGCGGGGGCGGCCCUAGCGA Click to Show/Hide
Ensembl ID	ENSG00000222071
HGNC ID	HGNC:35399
Precursor Accession	MI0008336
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Oxaliplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Colorectal carcinoma [ICD-11: 2B91.3]				[1]
Sensitive Disease	Colorectal carcinoma [ICD-11: 2B91.3]			Disease Info
Sensitive Drug	Oxaliplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
In Vitro Model	HCT116 cells	Colon	Homo sapiens (Human)	CVCL_0291
	HCT-116/L-OHP cells	Kidney	Homo sapiens (Human)	CVCL_0291
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	Elevated levels of miR-1915 in the mimics-transfected HCT116/L-OHP cells reduced Bcl-2 protein level and the luciferase activity of a Bcl-2 3'-untranslated region-based reporter, and also sensitized these cells to some anticancer drugs. miR-1915 could play a role in the development of MDR in colorectal carcinoma cells at least in part by modulation of apoptosis via targeting Bcl-2.

References

Ref 1	miR-1915 inhibits Bcl-2 to modulate multidrug resistance by increasing drug-sensitivity in human colorectal carcinoma cells. Mol Carcinog. 2013 Jan;52(1):70-8. doi: 10.1002/mc.21832. Epub 2011 Nov 28.