Molecule Information

General Information of the Molecule (ID: Mol01542)
Name
hsa-mir-1915 ,Homo sapiens
Synonyms
microRNA 1915
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR1915
Gene ID
100302129
Location
chr10:21496562-21496641[-]
Sequence
UGAGAGGCCGCACCUUGCCUUGCUGCCCGGGCCGUGCACCCGUGGGCCCCAGGGCGACGC
GGCGGGGGCGGCCCUAGCGA
    Click to Show/Hide
Ensembl ID
ENSG00000222071
HGNC ID
HGNC:35399
Precursor Accession
MI0008336
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [2]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR; Luciferase assay
Experiment for
Drug Resistance		 Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is down-regulated in doxorubicin-sensitive cells
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [2]
Sensitive Disease Renal cell carcinoma [ICD-11: 2C90.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR; Luciferase assay
Experiment for
Drug Resistance		 Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is down-regulated in doxorubicin-sensitive cells
Mitomycin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Mitomycin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCT-116 cells Colon Homo sapiens (Human) CVCL_0291
HCT-116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration		 miRNA Microarray Analysis; qRT-PCR; Luciferase Activity Assay; Western Blot; Semi-Quantitative RT-PCR
Experiment for
Drug Resistance		 Caspase-3 Activity Assay; In Vitro Drug Sensitivity Assay; Flow Cytometric
Mechanism Description Taken together, our findings suggest that miR-1915 could play a role in the development of MDR in colorectal carcinoma cells at least in part by modulation of apoptosis via targeting Bcl-2.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal carcinoma [ICD-11: 2B91.3] [5]
Sensitive Disease Colorectal carcinoma [ICD-11: 2B91.3]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HCT-116/L-OHP cells Kidney Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Elevated levels of miR-1915 in the mimics-transfected HCT116/L-OHP cells reduced Bcl-2 protein level and the luciferase activity of a Bcl-2 3'-untranslated region-based reporter, and also sensitized these cells to some anticancer drugs. miR-1915 could play a role in the development of MDR in colorectal carcinoma cells at least in part by modulation of apoptosis via targeting Bcl-2.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCT-116 cells Colon Homo sapiens (Human) CVCL_0291
HCT-116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration		 miRNA Microarray Analysis; qRT-PCR; Luciferase Activity Assay; Western Blot; Semi-Quantitative RT-PCR
Experiment for
Drug Resistance		 Caspase-3 Activity Assay; In Vitro Drug Sensitivity Assay; Flow Cytometric
Mechanism Description Taken together, our findings suggest that miR-1915 could play a role in the development of MDR in colorectal carcinoma cells at least in part by modulation of apoptosis via targeting Bcl-2.
References
Ref 1 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
Ref 2 The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
Ref 3 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 4 The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 5 miR-1915 inhibits Bcl-2 to modulate multidrug resistance by increasing drug-sensitivity in human colorectal carcinoma cells. Mol Carcinog. 2013 Jan;52(1):70-8. doi: 10.1002/mc.21832. Epub 2011 Nov 28.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.