Molecule Information

General Information of the Molecule (ID: Mol01538)
Name
hsa-mir-216b ,Homo sapiens
Synonyms
microRNA 216b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR216B
Gene ID
100126319
Location
chr2:56000714-56000795[-]
Sequence
GCAGACUGGAAAAUCUCUGCAGGCAAAUGUGAUGUCACUGAGGAAAUCACACACUUACCC
GUAGAGAUUCUACAGUCUGACA
    Click to Show/Hide
Ensembl ID
ENSG00000211520
HGNC ID
HGNC:33668
Precursor Accession
MI0005569
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation c-Jun/BCL-xl signaling pathway Inhibition hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
PC9 cells Lung Homo sapiens (Human) CVCL_B260
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Overexpression of miR216b sensitizes NSCLC cells to cisplatin-induced apoptosis by decreasing the expression of c-Jun and inhibiting the c-Jun/Bcl-xl pathway.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
SkOV3/CDDP cells Ovary Homo sapiens (Human) CVCL_D622
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay; CCK8 assay
Mechanism Description miR216b increases cisplatin sensitivity in ovarian cancer cells by targeting PARP1.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [3]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [4]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/PTEN/AKT signaling pathway Regulation N.A.
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
COLO 205 cells Colon Homo sapiens (Human) CVCL_0218
CCD-18Co cells Colon Homo sapiens (Human) CVCL_2379
COLO-678 cells Colon Homo sapiens (Human) CVCL_1129
HT55 cells Colon Homo sapiens (Human) CVCL_1294
LS1034 cells Colon Homo sapiens (Human) CVCL_1382
SW1417 cells Colon Homo sapiens (Human) CVCL_1717
SW403 cells Colon Homo sapiens (Human) CVCL_0545
SW48 cells Colon Homo sapiens (Human) CVCL_1724
In Vivo Model BALB/c mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR-216b promotes cell growth and enhances chemosensitivity of colorectal cancer by suppressing PDZ-binding kinase.
Vemurafenib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [5]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
 Disease Info 
Sensitive Drug Vemurafenib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell autophagy Inhibition hsa04140
In Vitro Model A375 cells Skin Homo sapiens (Human) CVCL_0132
A375-R cells Skin Homo sapiens (Human) CVCL_6234
G-361 cells Skin Homo sapiens (Human) CVCL_1220
G361/R cells Skin Homo sapiens (Human) CVCL_IW13
MeWo cells Skin Homo sapiens (Human) CVCL_0445
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometric analysis
Mechanism Description miR216b enhances the efficacy of vemurafenib by targeting Beclin-1, UVRAG and ATG5 in melanoma. miR216b suppresses autophagy in both BRAFi-sensitive and -resistant melanoma cells.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [3]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Verapamil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
References
Ref 1 Overexpression of miR-216b sensitizes NSCLC cells to cisplatin-induced apoptosis by targeting c-Jun. Oncotarget. 2017 Oct 27;8(61):104206-104215. doi: 10.18632/oncotarget.22171. eCollection 2017 Nov 28.
Ref 2 MiR-216b increases cisplatin sensitivity in ovarian cancer cells by targeting PARP1. Cancer Gene Ther. 2017 May;24(5):208-214. doi: 10.1038/cgt.2017.6. Epub 2017 Mar 10.
Ref 3 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
Ref 4 miR-216b promotes cell growth and enhances chemosensitivity of colorectal cancer by suppressing PDZ-binding kinase. Biochem Biophys Res Commun. 2017 Jun 24;488(2):247-252. doi: 10.1016/j.bbrc.2017.03.162. Epub 2017 Mar 31.
Ref 5 miR-216b enhances the efficacy of vemurafenib by targeting Beclin-1, UVRAG and ATG5 in melanoma. Cell Signal. 2018 Jan;42:30-43. doi: 10.1016/j.cellsig.2017.09.024. Epub 2017 Oct 2.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.