Molecule Information
General Information of the Molecule (ID: Mol01538)
Name |
hsa-mir-216b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 216b
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR216B
|
||||
Gene ID | |||||
Location |
chr2:56000714-56000795[-]
|
||||
Sequence |
GCAGACUGGAAAAUCUCUGCAGGCAAAUGUGAUGUCACUGAGGAAAUCACACACUUACCC
GUAGAGAUUCUACAGUCUGACA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | c-Jun/BCL-xl signaling pathway | Inhibition | hsa04210 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Overexpression of miR216b sensitizes NSCLC cells to cisplatin-induced apoptosis by decreasing the expression of c-Jun and inhibiting the c-Jun/Bcl-xl pathway. | |||
Disease Class: Ovarian cancer | [2] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
SkOV3/CDDP cells | Ovary | Homo sapiens (Human) | CVCL_D622 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay; CCK8 assay | |||
Mechanism Description | miR216b increases cisplatin sensitivity in ovarian cancer cells by targeting PARP1. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [3] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | PI3K/PTEN/AKT signaling pathway | Regulation | hsa04151 | |
In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
COLO 205 cells | Colon | Homo sapiens (Human) | CVCL_0218 | |
CCD-18Co cells | Colon | Homo sapiens (Human) | CVCL_2379 | |
COLO-678 cells | Colon | Homo sapiens (Human) | CVCL_1129 | |
HT55 cells | Colon | Homo sapiens (Human) | CVCL_1294 | |
LS1034 cells | Colon | Homo sapiens (Human) | CVCL_1382 | |
SW1417 cells | Colon | Homo sapiens (Human) | CVCL_1717 | |
SW403 cells | Colon | Homo sapiens (Human) | CVCL_0545 | |
SW48 cells | Colon | Homo sapiens (Human) | CVCL_1724 | |
In Vivo Model | BALB/c mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-216b promotes cell growth and enhances chemosensitivity of colorectal cancer by suppressing PDZ-binding kinase. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Melanoma | [4] | |||
Sensitive Disease | Melanoma [ICD-11: 2C30.0] | |||
Sensitive Drug | Vemurafenib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell autophagy | Inhibition | hsa04140 | |
In Vitro Model | A375 cells | Skin | Homo sapiens (Human) | CVCL_0132 |
A375-R cells | Skin | Homo sapiens (Human) | CVCL_6234 | |
G-361 cells | Skin | Homo sapiens (Human) | CVCL_1220 | |
G361/R cells | Skin | Homo sapiens (Human) | CVCL_IW13 | |
MeWo cells | Skin | Homo sapiens (Human) | CVCL_0445 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
Mechanism Description | miR216b enhances the efficacy of vemurafenib by targeting Beclin-1, UVRAG and ATG5 in melanoma. miR216b suppresses autophagy in both BRAFi-sensitive and -resistant melanoma cells. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.