Molecule Information

General Information of the Molecule (ID: Mol01538)

• Name: hsa-mir-216b ,Homo sapiens
• Synonyms: microRNA 216b
• Molecule Type: Precursor miRNA
• Gene Name: MIR216B
• Gene ID: 100126319
• Location: chr2:56000714-56000795[-]
• Sequence:
  GCAGACUGGAAAAUCUCUGCAGGCAAAUGUGAUGUCACUGAGGAAAUCACACACUUACCC
  GUAGAGAUUCUACAGUCUGACA
• Ensembl ID: ENSG00000211520
• HGNC ID: HGNC:33668
• Precursor Accession: MI0005569

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: c-Jun/BCL-xl signaling pathway; Inhibition; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR216b sensitizes NSCLC cells to cisplatin-induced apoptosis by decreasing the expression of c-Jun and inhibiting the c-Jun/Bcl-xl pathway.

Disease Class: Ovarian cancer [2]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: SkOV3/CDDP cells; Ovary; Homo sapiens (Human); CVCL_D622
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay; CCK8 assay
• Mechanism Description: miR216b increases cisplatin sensitivity in ovarian cancer cells by targeting PARP1.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [3]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/PTEN/AKT signaling pathway; Regulation; hsa04151
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vitro Model: COLO 205 cells; Colon; Homo sapiens (Human); CVCL_0218
• In Vitro Model: CCD-18Co cells; Colon; Homo sapiens (Human); CVCL_2379
• In Vitro Model: COLO-678 cells; Colon; Homo sapiens (Human); CVCL_1129
• In Vitro Model: HT55 cells; Colon; Homo sapiens (Human); CVCL_1294
• In Vitro Model: LS1034 cells; Colon; Homo sapiens (Human); CVCL_1382
• In Vitro Model: SW1417 cells; Colon; Homo sapiens (Human); CVCL_1717
• In Vitro Model: SW403 cells; Colon; Homo sapiens (Human); CVCL_0545
• In Vitro Model: SW48 cells; Colon; Homo sapiens (Human); CVCL_1724
• In Vivo Model: BALB/c mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-216b promotes cell growth and enhances chemosensitivity of colorectal cancer by suppressing PDZ-binding kinase.

Vemurafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [4]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Vemurafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell autophagy; Inhibition; hsa04140
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vitro Model: A375-R cells; Skin; Homo sapiens (Human); CVCL_6234
• In Vitro Model: G-361 cells; Skin; Homo sapiens (Human); CVCL_1220
• In Vitro Model: G361/R cells; Skin; Homo sapiens (Human); CVCL_IW13
• In Vitro Model: MeWo cells; Skin; Homo sapiens (Human); CVCL_0445
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR216b enhances the efficacy of vemurafenib by targeting Beclin-1, UVRAG and ATG5 in melanoma. miR216b suppresses autophagy in both BRAFi-sensitive and -resistant melanoma cells.

References

• Ref 1: Overexpression of miR-216b sensitizes NSCLC cells to cisplatin-induced apoptosis by targeting c-Jun. Oncotarget. 2017 Oct 27;8(61):104206-104215. doi: 10.18632/oncotarget.22171. eCollection 2017 Nov 28.
• Ref 2: MiR-216b increases cisplatin sensitivity in ovarian cancer cells by targeting PARP1. Cancer Gene Ther. 2017 May;24(5):208-214. doi: 10.1038/cgt.2017.6. Epub 2017 Mar 10.
• Ref 3: miR-216b promotes cell growth and enhances chemosensitivity of colorectal cancer by suppressing PDZ-binding kinase. Biochem Biophys Res Commun. 2017 Jun 24;488(2):247-252. doi: 10.1016/j.bbrc.2017.03.162. Epub 2017 Mar 31.
• Ref 4: miR-216b enhances the efficacy of vemurafenib by targeting Beclin-1, UVRAG and ATG5 in melanoma. Cell Signal. 2018 Jan;42:30-43. doi: 10.1016/j.cellsig.2017.09.024. Epub 2017 Oct 2.