Molecule Information
General Information of the Molecule (ID: Mol01538)
| Name |
hsa-mir-216b
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 216b
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR216B
|
||||
| Gene ID | |||||
| Location |
chr2:56000714-56000795[-]
|
||||
| Sequence |
GCAGACUGGAAAAUCUCUGCAGGCAAAUGUGAUGUCACUGAGGAAAUCACACACUUACCC
GUAGAGAUUCUACAGUCUGACA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | c-Jun/BCL-xl signaling pathway | Inhibition | hsa04210 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of miR216b sensitizes NSCLC cells to cisplatin-induced apoptosis by decreasing the expression of c-Jun and inhibiting the c-Jun/Bcl-xl pathway. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [2] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| SkOV3/CDDP cells | Ovary | Homo sapiens (Human) | CVCL_D622 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay; CCK8 assay | |||
| Mechanism Description | miR216b increases cisplatin sensitivity in ovarian cancer cells by targeting PARP1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [3] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [4] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | PI3K/PTEN/AKT signaling pathway | Regulation | N.A. | |
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
| SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
| COLO 205 cells | Colon | Homo sapiens (Human) | CVCL_0218 | |
| CCD-18Co cells | Colon | Homo sapiens (Human) | CVCL_2379 | |
| COLO-678 cells | Colon | Homo sapiens (Human) | CVCL_1129 | |
| HT55 cells | Colon | Homo sapiens (Human) | CVCL_1294 | |
| LS1034 cells | Colon | Homo sapiens (Human) | CVCL_1382 | |
| SW1417 cells | Colon | Homo sapiens (Human) | CVCL_1717 | |
| SW403 cells | Colon | Homo sapiens (Human) | CVCL_0545 | |
| SW48 cells | Colon | Homo sapiens (Human) | CVCL_1724 | |
| In Vivo Model | BALB/c mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-216b promotes cell growth and enhances chemosensitivity of colorectal cancer by suppressing PDZ-binding kinase. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Melanoma [ICD-11: 2C30.0] | [5] | |||
| Sensitive Disease | Melanoma [ICD-11: 2C30.0] | |||
| Sensitive Drug | Vemurafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell autophagy | Inhibition | hsa04140 | |
| In Vitro Model | A375 cells | Skin | Homo sapiens (Human) | CVCL_0132 |
| A375-R cells | Skin | Homo sapiens (Human) | CVCL_6234 | |
| G-361 cells | Skin | Homo sapiens (Human) | CVCL_1220 | |
| G361/R cells | Skin | Homo sapiens (Human) | CVCL_IW13 | |
| MeWo cells | Skin | Homo sapiens (Human) | CVCL_0445 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
| Mechanism Description | miR216b enhances the efficacy of vemurafenib by targeting Beclin-1, UVRAG and ATG5 in melanoma. miR216b suppresses autophagy in both BRAFi-sensitive and -resistant melanoma cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [3] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Verapamil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
