General Information of the Molecule (ID: Mol01538)
Name
hsa-mir-216b ,Homo sapiens
Synonyms
microRNA 216b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR216B
Gene ID
100126319
Location
chr2:56000714-56000795[-]
Sequence
GCAGACUGGAAAAUCUCUGCAGGCAAAUGUGAUGUCACUGAGGAAAUCACACACUUACCC
GUAGAGAUUCUACAGUCUGACA
    Click to Show/Hide
Ensembl ID
ENSG00000211520
HGNC ID
HGNC:33668
Precursor Accession
MI0005569
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation c-Jun/BCL-xl signaling pathway Inhibition hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
PC9 cells Lung Homo sapiens (Human) CVCL_B260
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of miR216b sensitizes NSCLC cells to cisplatin-induced apoptosis by decreasing the expression of c-Jun and inhibiting the c-Jun/Bcl-xl pathway.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
SkOV3/CDDP cells Ovary Homo sapiens (Human) CVCL_D622
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay; CCK8 assay
Mechanism Description miR216b increases cisplatin sensitivity in ovarian cancer cells by targeting PARP1.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [3]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/PTEN/AKT signaling pathway Regulation N.A.
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
COLO 205 cells Colon Homo sapiens (Human) CVCL_0218
CCD-18Co cells Colon Homo sapiens (Human) CVCL_2379
COLO-678 cells Colon Homo sapiens (Human) CVCL_1129
HT55 cells Colon Homo sapiens (Human) CVCL_1294
LS1034 cells Colon Homo sapiens (Human) CVCL_1382
SW1417 cells Colon Homo sapiens (Human) CVCL_1717
SW403 cells Colon Homo sapiens (Human) CVCL_0545
SW48 cells Colon Homo sapiens (Human) CVCL_1724
In Vivo Model BALB/c mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-216b promotes cell growth and enhances chemosensitivity of colorectal cancer by suppressing PDZ-binding kinase.
Vemurafenib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [4]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
Sensitive Drug Vemurafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell autophagy Inhibition hsa04140
In Vitro Model A375 cells Skin Homo sapiens (Human) CVCL_0132
A375-R cells Skin Homo sapiens (Human) CVCL_6234
G-361 cells Skin Homo sapiens (Human) CVCL_1220
G361/R cells Skin Homo sapiens (Human) CVCL_IW13
MeWo cells Skin Homo sapiens (Human) CVCL_0445
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometric analysis
Mechanism Description miR216b enhances the efficacy of vemurafenib by targeting Beclin-1, UVRAG and ATG5 in melanoma. miR216b suppresses autophagy in both BRAFi-sensitive and -resistant melanoma cells.
References
Ref 1 Overexpression of miR-216b sensitizes NSCLC cells to cisplatin-induced apoptosis by targeting c-Jun. Oncotarget. 2017 Oct 27;8(61):104206-104215. doi: 10.18632/oncotarget.22171. eCollection 2017 Nov 28.
Ref 2 MiR-216b increases cisplatin sensitivity in ovarian cancer cells by targeting PARP1. Cancer Gene Ther. 2017 May;24(5):208-214. doi: 10.1038/cgt.2017.6. Epub 2017 Mar 10.
Ref 3 miR-216b promotes cell growth and enhances chemosensitivity of colorectal cancer by suppressing PDZ-binding kinase. Biochem Biophys Res Commun. 2017 Jun 24;488(2):247-252. doi: 10.1016/j.bbrc.2017.03.162. Epub 2017 Mar 31.
Ref 4 miR-216b enhances the efficacy of vemurafenib by targeting Beclin-1, UVRAG and ATG5 in melanoma. Cell Signal. 2018 Jan;42:30-43. doi: 10.1016/j.cellsig.2017.09.024. Epub 2017 Oct 2.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.