Molecule Information
General Information of the Molecule (ID: Mol01537)
| Name |
hsa-mir-374b
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 374b
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR374B
|
||||
| Gene ID | |||||
| Location |
chrX:74218547-74218618[-]
|
||||
| Sequence |
ACUCGGAUGGAUAUAAUACAACCUGCUAAGUGUCCUAGCACUUAGCAGGUUGUAUUAUCA
UUGUCCGUGUCU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [1] | |||
| Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | BxPC3-R cells | Pancreas | Homo sapiens (Human) | CVCL_XX78 |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
Resazurin conversion assay | |||
| Mechanism Description | The computational prediction that downregulation of miR-374b likely contributed to the acquisition of resistance to cisplatin in BxPC3-R cells was experimentally tested by transfection of miR-374b into BxPC3-R cells and subsequently measuring cisplatin sensitivity of these cells relative to controls. The results demonstrated that miR-374b transfection significantly reduced drug resistance in BxPC3-R cells to levels approaching those of the parental BxPC3 cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [2] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Sorafenib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | PKM2 mediated glycolysis signaling pathway | Activation | hsa05230 | |
| In Vitro Model | HCCLM3 cells | Liver | Homo sapiens (Human) | CVCL_6832 |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| In Vivo Model | SCID mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-374b/hnRNPA1/PkM2 axis functions as an important mechanism in sorafenib resistance, with sorafenib-induced miR-374b downregulation and subsequently elevated glycolysis. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [3] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| LCC2 cells | Breast | Homo sapiens (Human) | CVCL_DP51 | |
| LCC9 cells | Breast | Homo sapiens (Human) | CVCL_DP52 | |
| Experiment for Molecule Alteration |
Microarray analyses; qPCR; RT-PCR; Western blot | |||
| Mechanism Description | Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
