Molecule Information

General Information of the Molecule (ID: Mol01537)

• Name: hsa-mir-374b ,Homo sapiens
• Synonyms: microRNA 374b
• Molecule Type: Precursor miRNA
• Gene Name: MIR374B
• Gene ID: 100126317
• Location: chrX:74218547-74218618[-]
• Sequence:
  ACUCGGAUGGAUAUAAUACAACCUGCUAAGUGUCCUAGCACUUAGCAGGUUGUAUUAUCA
  UUGUCCGUGUCU
• Ensembl ID: ENSG00000212027
• HGNC ID: HGNC:33665
• Precursor Accession: MI0005566

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [1]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: BxPC3-R cells; Pancreas; Homo sapiens (Human); CVCL_XX78
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Resazurin conversion assay
• Mechanism Description: The computational prediction that downregulation of miR-374b likely contributed to the acquisition of resistance to cisplatin in BxPC3-R cells was experimentally tested by transfection of miR-374b into BxPC3-R cells and subsequently measuring cisplatin sensitivity of these cells relative to controls. The results demonstrated that miR-374b transfection significantly reduced drug resistance in BxPC3-R cells to levels approaching those of the parental BxPC3 cells.

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [2]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PKM2 mediated glycolysis signaling pathway; Activation; hsa05230
• In Vitro Model: HCCLM3 cells; Liver; Homo sapiens (Human); CVCL_6832
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vivo Model: SCID mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-374b/hnRNPA1/PkM2 axis functions as an important mechanism in sorafenib resistance, with sorafenib-induced miR-374b downregulation and subsequently elevated glycolysis.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

References

• Ref 1: Evidence for the role of microRNA 374b in acquired cisplatin resistance in pancreatic cancer cells. Cancer Gene Ther. 2016 Aug;23(8):241-5. doi: 10.1038/cgt.2016.23. Epub 2016 May 27.
• Ref 2: MiR-374b re-sensitizes hepatocellular carcinoma cells to sorafenib therapy by antagonizing PKM2-mediated glycolysis pathway. Am J Cancer Res. 2019 Apr 1;9(4):765-778. eCollection 2019.
• Ref 3: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.