Molecule Information

General Information of the Molecule (ID: Mol01533)

• Name: hsa-mir-675 ,Homo sapiens
• Synonyms: microRNA 675
• Molecule Type: Precursor miRNA
• Gene Name: MIR675
• Gene ID: 100033819
• Location: chr11:1996759-1996831[-]
• Sequence:
  CCCAGGGUCUGGUGCGGAGAGGGCCCACAGUGGACUUGGUGACGCUGUAUGCCCUCACCG
  CUCAGCCCCUGGG
• Ensembl ID: ENSG00000284010
• HGNC ID: HGNC:33351
• Precursor Accession: MI0005416

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: FADD/Caspase 8/Caspase 3 signaling pathway; Regulation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• In Vitro Model: SGC-7901/DDP cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis; Colony formation assay; Colony formation assay
• Mechanism Description: Long Noncoding RNA H19/miR675 Axis Promotes Gastric Cancer via FADD/Caspase 8/Caspase 3 signaling Pathway. H19/miR675 targets FADD and inhibits caspase 8/caspase 3, H19 inhibits the expression of FADD through miR675 targeting.

References

• Ref 1: Long Noncoding RNA H19/miR-675 Axis Promotes Gastric Cancer via FADD/Caspase 8/Caspase 3 Signaling Pathway. Cell Physiol Biochem. 2017;42(6):2364-2376. doi: 10.1159/000480028. Epub 2017 Aug 18.