Molecule Information
General Information of the Molecule (ID: Mol01533)
Name |
hsa-mir-675
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 675
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR675
|
||||
Gene ID | |||||
Location |
chr11:1996759-1996831[-]
|
||||
Sequence |
CCCAGGGUCUGGUGCGGAGAGGGCCCACAGUGGACUUGGUGACGCUGUAUGCCCUCACCG
CUCAGCCCCUGGG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | FADD/Caspase 8/Caspase 3 signaling pathway | Regulation | hsa04210 | |
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis; Colony formation assay; Colony formation assay | |||
Mechanism Description | Long Noncoding RNA H19/miR675 Axis Promotes Gastric Cancer via FADD/Caspase 8/Caspase 3 signaling Pathway. H19/miR675 targets FADD and inhibits caspase 8/caspase 3, H19 inhibits the expression of FADD through miR675 targeting. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.