Molecule Information

General Information of the Molecule (ID: Mol01530)

• Name: hsa-mir-1271 ,Homo sapiens
• Synonyms: microRNA 1271
• Molecule Type: Precursor miRNA
• Gene Name: MIR1271
• Gene ID: 100302203
• Location: chr5:176367946-176368031[+]
• Sequence:
  CACCCAGAUCAGUGCUUGGCACCUAGCAAGCACUCAGUAAAUAUUUGUUGAGUGCCUGCU
  AUGUGCCAGGCAUUGUGCUGAGGGCU
• Ensembl ID: ENSG00000221464
• HGNC ID: HGNC:35252
• Precursor Accession: MI0003814

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-1271 enhances the sensitivity of colorectal cancer cells to cisplatin via downregulating mTOP.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: IGF1R/IRS1 signaling pathway; Regulation; hsa04212
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Enforced miR-1271 expression repressed the protein levels of its targets, inhibited proliferation of SGC7901/DDP cells, and sensitized SGC7901/DDP cells to DDP-induced apoptosis. Overall, on the basis of the results of our study, we proposed that miR-1271 could regulate cisplatin resistance in human gastric cancer cells, at least partially, via targeting the IGF1R/IRS1 pathway.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [3]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: A172 cells; Brain; Homo sapiens (Human); CVCL_0131
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: The chemoresistant cell survival mediated with Bcl-2 was inhibited by overexpression of miR-1271 and was enhanced by depletion of miR-1271.

References

• Ref 1: miR-1271 enhances the sensitivity of colorectal cancer cells to cisplatin. Exp Ther Med. 2019 Jun;17(6):4363-4370. doi: 10.3892/etm.2019.7501. Epub 2019 Apr 18.
• Ref 2: miR-1271 regulates cisplatin resistance of human gastric cancer cell lines by targeting IGF1R, IRS1, mTOR, and BCL2. Anticancer Agents Med Chem. 2014;14(6):884-91. doi: 10.2174/1871520614666140528161318.
• Ref 3: Chemo-resistance of A172 glioblastoma cells is controlled by miR-1271-regulated Bcl-2. Biomed Pharmacother. 2018 Dec;108:734-740. doi: 10.1016/j.biopha.2018.08.102. Epub 2018 Sep 21.