Molecule Information

General Information of the Molecule (ID: Mol01529)

• Name: hsa-mir-411 ,Homo sapiens
• Synonyms: microRNA 411
• Molecule Type: Precursor miRNA
• Gene Name: MIR411
• Gene ID: 693121
• Location: chr14:101023325-101023420[+]
• Sequence:
  UGGUACUUGGAGAGAUAGUAGACCGUAUAGCGUACGCUUUAUCUGUGACGUAUGUAACAC
  GGUCCACUAACCCUCAGUAUCAAAUCCAUCCCCGAG
• Ensembl ID: ENSG00000199109
• HGNC ID: HGNC:32792
• Precursor Accession: MI0003675

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: IOSE386 cells; Ovary; Homo sapiens (Human); CVCL_E230
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: TUOC1 cells; Ovary; Homo sapiens (Human); CVCL_L700
• In Vitro Model: OVCAR-3 cells; Ascites; Homo sapiens (Human); CVCL_0465
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vitro Model: C13 cells; Ovary; Homo sapiens (Human); CVCL_0114
• In Vitro Model: KK cells; Ascites; Homo sapiens (Human); CVCL_F844
• In Vitro Model: KOC7C cells; Pleural effusion; Homo sapiens (Human); CVCL_5307
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Seventeen miRNAs were overexpressed in Taxol-resistant cells, including miR-663, miR-622, and HS_188

Pemetrexed

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [3]

• Sensitive Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Sensitive Drug: Pemetrexed
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• In Vitro Model: ACC-MESO1 cells; Lung; Homo sapiens (Human); CVCL_5113
• In Vitro Model: ACC-MESO4 cells; Lung; Homo sapiens (Human); CVCL_5114
• In Vitro Model: NCI-H2052 cells; Lung; Homo sapiens (Human); CVCL_1518
• In Vitro Model: NCI-H2452 cells; Lung; Homo sapiens (Human); CVCL_1553
• In Vitro Model: NCI-H28 cells; Lung; Homo sapiens (Human); CVCL_1555
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-379 and miR-411 play a key role in the carcinogenesis of MPM cells by targeting IL-18 and contributing to the sensitivity of MPM cells to SAHA and PEM.

Vorinostat

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [3]

• Sensitive Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Sensitive Drug: Vorinostat
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• In Vitro Model: ACC-MESO1 cells; Lung; Homo sapiens (Human); CVCL_5113
• In Vitro Model: ACC-MESO4 cells; Lung; Homo sapiens (Human); CVCL_5114
• In Vitro Model: NCI-H2052 cells; Lung; Homo sapiens (Human); CVCL_1518
• In Vitro Model: NCI-H2452 cells; Lung; Homo sapiens (Human); CVCL_1553
• In Vitro Model: NCI-H28 cells; Lung; Homo sapiens (Human); CVCL_1555
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-379 and miR-411 play a key role in the carcinogenesis of MPM cells by targeting IL-18 and contributing to the sensitivity of MPM cells to SAHA and PEM.

References

• Ref 1: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 2: Overcoming acquired BRAF inhibitor resistance in melanoma via targeted inhibition of Hsp90 with ganetespibMol Cancer Ther. 2014 Feb;13(2):353-63. doi: 10.1158/1535-7163.MCT-13-0481. Epub 2014 Jan 7.
• Ref 3: MiR-379/411 cluster regulates IL-18 and contributes to drug resistance in malignant pleural mesothelioma. Oncol Rep. 2014 Dec;32(6):2365-72. doi: 10.3892/or.2014.3481. Epub 2014 Sep 16.