Molecule Information
General Information of the Molecule (ID: Mol01520)
Name |
hsa-mir-539
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 539
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR539
|
||||
Gene ID | |||||
Location |
chr14:101047321-101047398[+]
|
||||
Sequence |
AUACUUGAGGAGAAAUUAUCCUUGGUGUGUUCGCUUUAUUUAUGAUGAAUCAUACAAGGA
CAAUUUCUUUUUGAGUAU Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Arsenic trioxide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
PLC/PRF/5 cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
Skhep1 cells | Liver | Homo sapiens (Human) | CVCL_0525 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Colony formation assay; Flow cytometry assay | |||
Mechanism Description | microRNA-539 suppresses tumor growth and tumorigenesis and overcomes arsenic trioxide resistance in hepatocellular carcinoma. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [2] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell viability | Activation | hsa05200 | ||
PI3K/AKT/mTOR signaling pathway | Activation | hsa04151 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR-539 enhances chemosensitivity to cisplatin in non-small cell lung cancer by targeting DCLk1. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.