Molecule Information

General Information of the Molecule (ID: Mol01519)

• Name: hsa-mir-514 ,Homo sapiens
• Synonyms: microRNA 514a-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR514A1
• Gene ID: 574516
• Location: chrX:147279247-147279344[-]
• Sequence:
  AACAUGUUGUCUGUGGUACCCUACUCUGGAGAGUGACAAUCAUGUAUAAUUAAAUUUGAU
  UGACACUUCUGUGAGUAGAGUAACGCAUGACACGUACG
• Ensembl ID: ENSG00000207868
• HGNC ID: HGNC:32148
• Precursor Accession: MI0003198

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; colony-formation assay; Soft-agar colony-formation assay
• Mechanism Description: miR-514 repressed proliferation and decreased cisplatin chemosensitivity in ovarian cancer cells by targeting ATP binding cassette subfamily.

References

• Ref 1: MiR-514 attenuates proliferation and increases chemoresistance by targeting ATP binding cassette subfamily in ovarian cancer. Mol Genet Genomics. 2018 Oct;293(5):1159-1167. doi: 10.1007/s00438-018-1447-0. Epub 2018 May 11.