Molecule Information

General Information of the Molecule (ID: Mol01518)

• Name: hsa-mir-506 ,Homo sapiens
• Synonyms: microRNA 506
• Molecule Type: Precursor miRNA
• Gene Name: MIR506
• Gene ID: 574511
• Location: chrX:147230720-147230843[-]
• Sequence:
  GCCACCACCAUCAGCCAUACUAUGUGUAGUGCCUUAUUCAGGAAGGUGUUACUUAAUAGA
  UUAAUAUUUGUAAGGCACCCUUCUGAGUAGAGUAAUGUGCAACAUGGACAACAUUUGUGG
  UGGC
• Ensembl ID: ENSG00000207731
• HGNC ID: HGNC:32143
• Precursor Accession: MI0003193

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian serous carcinoma [ICD-11: 2C73.2] [1]

• Sensitive Disease: Ovarian serous carcinoma [ICD-11: 2C73.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: CDK4/6-FOXM1 signaling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: Hey A8 cells; Ovary; Homo sapiens (Human); CVCL_8878
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-506 overexpression sensitized ovarian cancer cells to cisplatin or to a commercially available PARP inhibitor (olaparib) due to miR-506 overexpression decreasing RAD51 levels and homologous recombination efficiency.

Olaparib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian serous carcinoma [ICD-11: 2C73.2] [1]

• Sensitive Disease: Ovarian serous carcinoma [ICD-11: 2C73.2]
• Sensitive Drug: Olaparib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: CDK4/6-FOXM1 signaling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Homologous recombination-mediated repair pathway; Inhibition; hsa03440
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: Hey A8 cells; Ovary; Homo sapiens (Human); CVCL_8878
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-506 overexpression sensitized ovarian cancer cells to cisplatin or to a commercially available PARP inhibitor (olaparib) due to miR-506 overexpression decreasing RAD51 levels and homologous recombination efficiency.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [2]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Inhibition; hsa04310
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT116-OxR cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR-506 overexpression in HCT116-OxR cells enhances oxaliplatin sensitivity by inhibiting MDR1/P-gp expression via down-regulation of the Wnt/beta-catenin pathway.

Clinical Trial Drug(s) 1 drug(s) in total

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [3]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: SW1116 cells; Colon; Homo sapiens (Human); CVCL_0544
• In Vitro Model: SW1116/HCPT; Colon; Homo sapiens (Human); CVCL_0544
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-506 over-expression in established HCPT-resistant colon cancer cell line confers resistance to HCPT by inhibiting PPARalpha expression.

References

• Ref 1: Augmentation of response to chemotherapy by microRNA-506 through regulation of RAD51 in serous ovarian cancers. J Natl Cancer Inst. 2015 May 20;107(7):djv108. doi: 10.1093/jnci/djv108. Print 2015 Jul.
• Ref 2: miR-506 enhances the sensitivity of human colorectal cancer cells to oxaliplatin by suppressing MDR1/P-gp expression. Cell Prolif. 2017 Jun;50(3):e12341. doi: 10.1111/cpr.12341. Epub 2017 Feb 19.
• Ref 3: MicroRNA 506 regulates expression of PPAR alpha in hydroxycamptothecin-resistant human colon cancer cells. FEBS Lett. 2011 Nov 16;585(22):3560-8. doi: 10.1016/j.febslet.2011.10.021. Epub 2011 Oct 22.