Molecule Information

General Information of the Molecule (ID: Mol01517)

• Name: hsa-mir-505 ,Homo sapiens
• Synonyms: microRNA 505
• Molecule Type: Precursor miRNA
• Gene Name: MIR505
• Gene ID: 574508
• Location: chrX:139924148-139924231[-]
• Sequence:
  GAUGCACCCAGUGGGGGAGCCAGGAAGUAUUGAUGUUUCUGCCAGUUUAGCGUCAACACU
  UGCUGGUUUCCUCUCUGGAGCAUC
• Ensembl ID: ENSG00000207633
• HGNC ID: HGNC:32140
• Precursor Accession: MI0003190

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: LS174T cells; Colon; Homo sapiens (Human); CVCL_1384
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony-forming assay; Transwell assay; Wound healing assay; Flow cytometry assay
• Mechanism Description: miR-505 advanced MTX-induced LS174T cells migration and invasiveness as well as depressed LS174T/MTX cell apoptosis through the down-regulation of RASSF8.

References

• Ref 1: MiR-505 mediates methotrexate resistance in colorectal cancer by targeting RASSF8. J Pharm Pharmacol. 2018 Jul;70(7):937-951. doi: 10.1111/jphp.12913. Epub 2018 May 3.