Molecule Information
General Information of the Molecule (ID: Mol01517)
Name |
hsa-mir-505
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 505
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR505
|
||||
Gene ID | |||||
Location |
chrX:139924148-139924231[-]
|
||||
Sequence |
GAUGCACCCAGUGGGGGAGCCAGGAAGUAUUGAUGUUUCUGCCAGUUUAGCGUCAACACU
UGCUGGUUUCCUCUCUGGAGCAUC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [1] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Methotrexate | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
Cell viability | Activation | hsa05200 | ||
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
LS174T cells | Colon | Homo sapiens (Human) | CVCL_1384 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Colony-forming assay; Transwell assay; Wound healing assay; Flow cytometry assay | |||
Mechanism Description | miR-505 advanced MTX-induced LS174T cells migration and invasiveness as well as depressed LS174T/MTX cell apoptosis through the down-regulation of RASSF8. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.