Molecule Information
General Information of the Molecule (ID: Mol01515)
Name |
hsa-mir-519a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 519a-1
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR519A1
|
||||
Gene ID | |||||
Location |
chr19:53752397-53752481[+]
|
||||
Sequence |
CUCAGGCUGUGACACUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAGGAAAGUGCA
UCCUUUUAGAGUGUUACUGUUUGAG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Tamoxifen | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
BT474 cells | Breast | Homo sapiens (Human) | CVCL_0179 | |
MCF7/TAMR cells | Breast | Homo sapiens (Human) | CVCL_EG55 | |
CAMA-1 cells | Breast | Homo sapiens (Human) | CVCL_1115 | |
HEK293 FT cells | Kidney | Homo sapiens (Human) | CVCL_6911 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Promega assay | |||
Mechanism Description | Tamoxifen-resistant cells express miRNA-519a at high levels, which directly represses the expression of PTEN, RB1, and CDkN1A, central nodes of a dense network, allowing the cells to proliferate, even in the presence of tamoxifen. miRNA-519a increases viability and S-phase population of the cell cycle, but does not affect EMT or invasion. miRNA-519a-expressing cells evade tamoxifen-induced apoptosis. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.