Molecule Information

General Information of the Molecule (ID: Mol01512)

• Name: hsa-mir-519d ,Homo sapiens
• Synonyms: microRNA 519d
• Molecule Type: Precursor miRNA
• Gene Name: MIR519D
• Gene ID: 574480
• Location: chr19:53713347-53713434[+]
• Sequence:
  UCCCAUGCUGUGACCCUCCAAAGGGAAGCGCUUUCUGUUUGUUUUCUCUUAAACAAAGUG
  CCUCCCUUUAGAGUGUUACCGUUUGGGA
• Ensembl ID: ENSG00000207981
• HGNC ID: HGNC:32112
• Precursor Accession: MI0003162

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: MCL-1 dependent mitochondria signaling pathway; Activation; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR519d impedes cisplatin-resistance in breast cancer stem cells by down-regulating the expression of MCL-1.

References

• Ref 1: MiR-519d impedes cisplatin-resistance in breast cancer stem cells by down-regulating the expression of MCL-1. Oncotarget. 2017 Mar 28;8(13):22003-22013. doi: 10.18632/oncotarget.15781.