Molecule Information

General Information of the Molecule (ID: Mol01511)

• Name: hsa-mir-520f ,Homo sapiens
• Synonyms: microRNA 520f
• Molecule Type: Precursor miRNA
• Gene Name: MIR520F
• Gene ID: 574464
• Location: chr19:53682159-53682245[+]
• Sequence:
  UCUCAGGCUGUGACCCUCUAAAGGGAAGCGCUUUCUGUGGUCAGAAAGAAAAGCAAGUGC
  UUCCUUUUAGAGGGUUACCGUUUGGGA
• Ensembl ID: ENSG00000283540
• HGNC ID: HGNC:32096
• Precursor Accession: MI0003146

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.11] [1]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.11]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: Sk-N-AS cells; Adrenal; Homo sapiens (Human); CVCL_1700
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Acid phosphatase assay
• Mechanism Description: Significant overexpression of NAIP mRNA and protein was documented, while experimental modulation of NAIP levels in both Sk-N-AsCis24 and in parental Sk-N-AS cells confirmed that NAIP was responsible for the drug resistant phenotype by apoptosis inhibition. Furthermore, a decrease in the NAIP targeting microRNA, miR-520f, was also demonstrated to be partially responsible for increased NAIP levels in Sk-N-AsCis24. Interestingly, miR-520f levels were determined to be significantly lower in postchemotherapy treatment tumours relative to matched prechemotherapy samples, consistent with a role for this miRNA in the acquisition of drug resistance in vivo, potentially through decreased NAIP targeting.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: TOV21G cells; Ovary; Homo sapiens (Human); CVCL_3613
• In Vitro Model: TOV112D cells; Ovary; Homo sapiens (Human); CVCL_3612
• In Vitro Model: C13 cells; Ovary; Homo sapiens (Human); CVCL_0114
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vitro Model: A2780CP cells; Ovary; Homo sapiens (Human); CVCL_0135
• In Vitro Model: A2780s cells; Ovary; Homo sapiens (Human); CVCL_4863
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: OVCAR5 cells; Ovary; Homo sapiens (Human); CVCL_1628
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: miRNA probe assay
• Experiment for Drug Resistance: Cell proliferation assays
• Mechanism Description: MicroRNAs (miRNAs) are 19 to 25-nucleotide, non-coding, RNA transcripts, thought to be instrumental in controlling eukaryotic cell function via modulation of post-transcriptional activity of multiple target mRNA genes by repression of translation or regulation of mRNA degradation.

References

• Ref 1: Modulation of chemotherapeutic drug resistance in neuroblastoma SK-N-AS cells by the neural apoptosis inhibitory protein and miR-520f. Int J Cancer. 2015 Apr 1;136(7):1579-88. doi: 10.1002/ijc.29144. Epub 2014 Sep 2.
• Ref 2: Sequential development of mutant clones in an imatinib resistant chronic myeloid leukaemia patient following sequential treatment with multiple tyrosine kinase inhibitors: an emerging problem . Cancer Chemother Pharmacol. 2009 Jun;64(1):195-7. doi: 10.1007/s00280-008-0905-5. Epub 2009 Jan 21.