Molecule Information

General Information of the Molecule (ID: Mol01511)

Name	hsa-mir-520f ,Homo sapiens
Synonyms	microRNA 520f Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR520F
Gene ID	574464
Location	chr19:53682159-53682245[+]
Sequence	UCUCAGGCUGUGACCCUCUAAAGGGAAGCGCUUUCUGUGGUCAGAAAGAAAAGCAAGUGC UUCCUUUUAGAGGGUUACCGUUUGGGA Click to Show/Hide
Ensembl ID	ENSG00000283540
HGNC ID	HGNC:32096
Precursor Accession	MI0003146
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Neuroblastoma				[1]
Resistant Disease	Neuroblastoma [ICD-11: 2A00.11]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell invasion		Activation	hsa05200
	Cell migration		Activation	hsa04670
In Vitro Model	Sk-N-AS cells	Adrenal	Homo sapiens (Human)	CVCL_1700
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Acid phosphatase assay
Mechanism Description	Significant overexpression of NAIP mRNA and protein was documented, while experimental modulation of NAIP levels in both Sk-N-AsCis24 and in parental Sk-N-AS cells confirmed that NAIP was responsible for the drug resistant phenotype by apoptosis inhibition. Furthermore, a decrease in the NAIP targeting microRNA, miR-520f, was also demonstrated to be partially responsible for increased NAIP levels in Sk-N-AsCis24. Interestingly, miR-520f levels were determined to be significantly lower in postchemotherapy treatment tumours relative to matched prechemotherapy samples, consistent with a role for this miRNA in the acquisition of drug resistance in vivo, potentially through decreased NAIP targeting.

References

Ref 1	Modulation of chemotherapeutic drug resistance in neuroblastoma SK-N-AS cells by the neural apoptosis inhibitory protein and miR-520f. Int J Cancer. 2015 Apr 1;136(7):1579-88. doi: 10.1002/ijc.29144. Epub 2014 Sep 2.