Molecule Information

General Information of the Molecule (ID: Mol01505)

• Name: hsa-mir-493 ,Homo sapiens
• Synonyms: microRNA 493
• Molecule Type: Precursor miRNA
• Gene Name: MIR493
• Gene ID: 574450
• Location: chr14:100869060-100869148[+]
• Sequence:
  CUGGCCUCCAGGGCUUUGUACAUGGUAGGCUUUCAUUCAUUCGUUUGCACAUUCGGUGAA
  GGUCUACUGUGUGCCAGGCCCUGUGCCAG
• Ensembl ID: ENSG00000207989
• HGNC ID: HGNC:32082
• Precursor Accession: MI0003132

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: miR493/DKK1 signaling pathway; Regulation; hsa05206
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: MkN28 cells; Gastric; Homo sapiens (Human); CVCL_1416
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Dkk1 expression was markedly decreased in GC tissues and serum samples. Dkk1 expression inversely correlated with miR-493 levels and is a direct target of miR-493. Moreover, miR-493 modulated the proliferation, invasion and chemo-sensitivity of GC cells via suppressing Dkk1 expression.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [2]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT/NF-kB signaling pathway; Activation; hsa04151
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: 95D cells; Lung; Homo sapiens (Human); CVCL_7110
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; RT-PCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay
• Mechanism Description: Epigenetic silencing of miR493 increases the resistance to cisplatin in lung cancer by targeting tongue cancer resistance-related protein 1(TCRP1). TCRP1 mediated a specific resistance to cDDP part due to activation of the PI3k/Akt/NF-kB signaling pathway.

References

• Ref 1: miR-493 mediated DKK1 down-regulation confers proliferation, invasion and chemo-resistance in gastric cancer cells. Oncotarget. 2016 Feb 9;7(6):7044-54. doi: 10.18632/oncotarget.6951.
• Ref 2: Epigenetic silencing of miR-493 increases the resistance to cisplatin in lung cancer by targeting tongue cancer resistance-related protein 1(TCRP1). J Exp Clin Cancer Res. 2017 Aug 31;36(1):114. doi: 10.1186/s13046-017-0582-5.