General Information of the Molecule (ID: Mol01505)
Name
hsa-mir-493 ,Homo sapiens
Synonyms
microRNA 493
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR493
Gene ID
574450
Location
chr14:100869060-100869148[+]
Sequence
CUGGCCUCCAGGGCUUUGUACAUGGUAGGCUUUCAUUCAUUCGUUUGCACAUUCGGUGAA
GGUCUACUGUGUGCCAGGCCCUGUGCCAG
    Click to Show/Hide
Ensembl ID
ENSG00000207989
HGNC ID
HGNC:32082
Precursor Accession
MI0003132
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell proliferation Activation hsa05200
miR493/DKK1 signaling pathway Regulation N.A.
In Vitro Model MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
AGS cells Gastric Homo sapiens (Human) CVCL_0139
MkN28 cells Gastric Homo sapiens (Human) CVCL_1416
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Dkk1 expression was markedly decreased in GC tissues and serum samples. Dkk1 expression inversely correlated with miR-493 levels and is a direct target of miR-493. Moreover, miR-493 modulated the proliferation, invasion and chemo-sensitivity of GC cells via suppressing Dkk1 expression.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [2]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT/NF-kB signaling pathway Activation hsa04151
In Vitro Model H1975 cells Lung Homo sapiens (Human) CVCL_1511
A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1299 cells Lung Homo sapiens (Human) CVCL_0060
95D cells Lung Homo sapiens (Human) CVCL_7110
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; RT-PCR
Experiment for
Drug Resistance
MTS assay; Flow cytometry assay
Mechanism Description Epigenetic silencing of miR493 increases the resistance to cisplatin in lung cancer by targeting tongue cancer resistance-related protein 1(TCRP1). TCRP1 mediated a specific resistance to cDDP part due to activation of the PI3k/Akt/NF-kB signaling pathway.
References
Ref 1 miR-493 mediated DKK1 down-regulation confers proliferation, invasion and chemo-resistance in gastric cancer cells. Oncotarget. 2016 Feb 9;7(6):7044-54. doi: 10.18632/oncotarget.6951.
Ref 2 Epigenetic silencing of miR-493 increases the resistance to cisplatin in lung cancer by targeting tongue cancer resistance-related protein 1(TCRP1). J Exp Clin Cancer Res. 2017 Aug 31;36(1):114. doi: 10.1186/s13046-017-0582-5.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.