Molecule Information

General Information of the Molecule (ID: Mol01504)
Name
hsa-mir-202 ,Homo sapiens
Synonyms
microRNA 202
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR202
Gene ID
574448
Location
chr10:133247511-133247620[-]
Sequence
CGCCUCAGAGCCGCCCGCCGUUCCUUUUUCCUAUGCAUAUACUUCUUUGAGGAUCUGGCC
UAAAGAGGUAUAGGGCAUGGGAAAACGGGGCGGUCGGGUCCUCCCCAGCG
    Click to Show/Hide
Ensembl ID
ENSG00000284219
HGNC ID
HGNC:32080
Precursor Accession
MI0003130
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bortezomib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [ICD-11: 2A83.0] [1]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Bortezomib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation JNk/SAPk signaling pathway Activation hsa05161
In Vitro Model U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 WST-1 assay; Annexin V-FLUOS assay
Mechanism Description miR202 contributes to sensitizing MM cells to drug significantly via activing JNk/SAPk signaling pathway. miR202 mimics combined with Bort could inhibit proliferation and induce apoptosis of U266 cells through negative regulating target gene BAFF, which further inhibited the JNk/SAPk signaling pathway.
Disease Class: Multiple myeloma [ICD-11: 2A83.0] [2]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Bortezomib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
JNk/SAPk signaling pathway Regulation N.A.
In Vitro Model U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 WST assay
Mechanism Description miR-202 was functioned as a modulator of BAFF expression. miR-202 over-expression sensitized MM cells to bortezomib (Bort) but less to Thalidomide (Thal) and dexamethasone (Dex). miR-202 mimics in combination with Bort inhibited MM cell survival more effectively as compared with Bort treatment alone. Our study also provided experimental evidence that JNk/SAPk signaling pathway was involved in the regulatory effect of miR-202 on drug resistance of MM cells.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [3]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
MAPK/RAS signaling pathway Inhibition hsa04010
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H441 cells Lung Homo sapiens (Human) CVCL_1561
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The overexpression of miR-202 was found to inhibit the Ras/MAPk pathway by targeting the kRas gene.
Dexamethasone
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [ICD-11: 2A83.0] [2]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Dexamethasone
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
JNk/SAPk signaling pathway Regulation N.A.
In Vitro Model U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 WST assay
Mechanism Description miR-202 was functioned as a modulator of BAFF expression. miR-202 over-expression sensitized MM cells to bortezomib (Bort) but less to Thalidomide (Thal) and dexamethasone (Dex). miR-202 mimics in combination with Bort inhibited MM cell survival more effectively as compared with Bort treatment alone. Our study also provided experimental evidence that JNk/SAPk signaling pathway was involved in the regulatory effect of miR-202 on drug resistance of MM cells.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [4]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration		 RT-PCR; Luciferase activity assay; Western blot
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description This study aimed to explore miR-202 contributions to drug resistance in osteosarcoma
Etoposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [5]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Etoposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration		 qRT-PCR, Reverse Transcription and Running ABC Transporter TLDA
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Using miRNA microfluidic arrays from ABI, we determined the microRNA profile for MCF7VP cells compared to drug sensitive cells. Multiple miRNAs showed differential expression among the cell lines including hsa-miR-382, hsa-miR-23b and hsa-miR-885-5p, which were up-regulated (>2-fold increase) in MCF7VP cells and hsa-mir-218, hsa-miR-758 and hsa-miR-548d-5p, which were down-regulated (>2-fold decrease) in MCF7VP cells, suggesting that etoposide resistant MCF7 cells have a miRNA profile that is distinct from the MCF7 drug sensitive cell line.
Imatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [6]
Sensitive Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Sensitive Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
K562 cells Blood Homo sapiens (Human) CVCL_0004
Ku812 cells Bone marrow Homo sapiens (Human) CVCL_0379
KCL-22 cells Bone marrow Homo sapiens (Human) CVCL_2091
EM2 cells Bone Homo sapiens (Human) CVCL_1196
EM3 cells Bone Homo sapiens (Human) CVCL_2033
LAMA 84 cells Bone Homo sapiens (Human) CVCL_0388
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; BrdU assay; Caspase-3 assay
Mechanism Description Overexpression of miR-202 sensitized imatinib resistant CML through the miR-202-mediated glycolysis inhibition by targetting Hk2.
Thalidomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [ICD-11: 2A83.0] [2]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Thalidomide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
JNk/SAPk signaling pathway Regulation N.A.
In Vitro Model U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 WST assay
Mechanism Description miR-202 was functioned as a modulator of BAFF expression. miR-202 over-expression sensitized MM cells to bortezomib (Bort) but less to Thalidomide (Thal) and dexamethasone (Dex). miR-202 mimics in combination with Bort inhibited MM cell survival more effectively as compared with Bort treatment alone. Our study also provided experimental evidence that JNk/SAPk signaling pathway was involved in the regulatory effect of miR-202 on drug resistance of MM cells.
References
Ref 1 [miR-202 contributes to sensitizing MM cells to drug significantly via activing JNK/SAPK signaling pathway]. Zhonghua Xue Ye Xue Za Zhi. 2016 Nov 14;37(11):987-992. doi: 10.3760/cma.j.issn.0253-2727.2016.11.012.
Ref 2 Study on the Association Between miRNA-202 Expression and Drug Sensitivity in Multiple Myeloma Cells. Pathol Oncol Res. 2016 Jul;22(3):531-9. doi: 10.1007/s12253-015-0035-4. Epub 2015 Dec 21.
Ref 3 miR-202 Enhances the Anti-Tumor Effect of Cisplatin on Non-Small Cell Lung Cancer by Targeting the Ras/MAPK Pathway. Cell Physiol Biochem. 2018;51(5):2160-2171. doi: 10.1159/000495835. Epub 2018 Dec 6.
Ref 4 BGB-283, a Novel RAF Kinase and EGFR Inhibitor, Displays Potent Antitumor Activity in BRAF-Mutated Colorectal CancersMol Cancer Ther. 2015 Oct;14(10):2187-97. doi: 10.1158/1535-7163.MCT-15-0262. Epub 2015 Jul 24.
Ref 5 Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
Ref 6 Overexpression of miR-202 resensitizes imatinib resistant chronic myeloid leukemia cells through targetting Hexokinase 2. Biosci Rep. 2018 May 8;38(3):BSR20171383. doi: 10.1042/BSR20171383. Print 2018 Jun 29.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.