Molecule Information
General Information of the Molecule (ID: Mol01504)
Name |
hsa-mir-202
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 202
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR202
|
||||
Gene ID | |||||
Location |
chr10:133247511-133247620[-]
|
||||
Sequence |
CGCCUCAGAGCCGCCCGCCGUUCCUUUUUCCUAUGCAUAUACUUCUUUGAGGAUCUGGCC
UAAAGAGGUAUAGGGCAUGGGAAAACGGGGCGGUCGGGUCCUCCCCAGCG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Multiple myeloma | [1] | |||
Sensitive Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
Sensitive Drug | Bortezomib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | JNk/SAPk signaling pathway | Activation | hsa05161 | |
In Vitro Model | U266 cells | Bone marrow | Homo sapiens (Human) | CVCL_0566 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
WST-1 assay; Annexin V-FLUOS assay | |||
Mechanism Description | miR202 contributes to sensitizing MM cells to drug significantly via activing JNk/SAPk signaling pathway. miR202 mimics combined with Bort could inhibit proliferation and induce apoptosis of U266 cells through negative regulating target gene BAFF, which further inhibited the JNk/SAPk signaling pathway. | |||
Disease Class: Multiple myeloma | [2] | |||
Sensitive Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
Sensitive Drug | Bortezomib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
JNk/SAPk signaling pathway | Regulation | hsa05161 | ||
In Vitro Model | U266 cells | Bone marrow | Homo sapiens (Human) | CVCL_0566 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
WST assay | |||
Mechanism Description | miR-202 was functioned as a modulator of BAFF expression. miR-202 over-expression sensitized MM cells to bortezomib (Bort) but less to Thalidomide (Thal) and dexamethasone (Dex). miR-202 mimics in combination with Bort inhibited MM cell survival more effectively as compared with Bort treatment alone. Our study also provided experimental evidence that JNk/SAPk signaling pathway was involved in the regulatory effect of miR-202 on drug resistance of MM cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [3] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
MAPK/RAS signaling pathway | Inhibition | hsa04010 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
NCI-H441 cells | Lung | Homo sapiens (Human) | CVCL_1561 | |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | The overexpression of miR-202 was found to inhibit the Ras/MAPk pathway by targeting the kRas gene. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Multiple myeloma | [2] | |||
Sensitive Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
Sensitive Drug | Dexamethasone | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
JNk/SAPk signaling pathway | Regulation | hsa05161 | ||
In Vitro Model | U266 cells | Bone marrow | Homo sapiens (Human) | CVCL_0566 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
WST assay | |||
Mechanism Description | miR-202 was functioned as a modulator of BAFF expression. miR-202 over-expression sensitized MM cells to bortezomib (Bort) but less to Thalidomide (Thal) and dexamethasone (Dex). miR-202 mimics in combination with Bort inhibited MM cell survival more effectively as compared with Bort treatment alone. Our study also provided experimental evidence that JNk/SAPk signaling pathway was involved in the regulatory effect of miR-202 on drug resistance of MM cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Chronic myeloid leukemia | [4] | |||
Sensitive Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
Sensitive Drug | Imatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
In Vitro Model | HL60 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0002 |
K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 | |
Ku812 cells | Bone marrow | Homo sapiens (Human) | CVCL_0379 | |
KCL-22 cells | Bone marrow | Homo sapiens (Human) | CVCL_2091 | |
EM2 cells | Bone | Homo sapiens (Human) | CVCL_1196 | |
EM3 cells | Bone | Homo sapiens (Human) | CVCL_2033 | |
LAMA 84 cells | Bone | Homo sapiens (Human) | CVCL_0388 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; BrdU assay; Caspase-3 assay | |||
Mechanism Description | Overexpression of miR-202 sensitized imatinib resistant CML through the miR-202-mediated glycolysis inhibition by targetting Hk2. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Multiple myeloma | [2] | |||
Sensitive Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
Sensitive Drug | Thalidomide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
JNk/SAPk signaling pathway | Regulation | hsa05161 | ||
In Vitro Model | U266 cells | Bone marrow | Homo sapiens (Human) | CVCL_0566 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
WST assay | |||
Mechanism Description | miR-202 was functioned as a modulator of BAFF expression. miR-202 over-expression sensitized MM cells to bortezomib (Bort) but less to Thalidomide (Thal) and dexamethasone (Dex). miR-202 mimics in combination with Bort inhibited MM cell survival more effectively as compared with Bort treatment alone. Our study also provided experimental evidence that JNk/SAPk signaling pathway was involved in the regulatory effect of miR-202 on drug resistance of MM cells. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.