Molecule Information

General Information of the Molecule (ID: Mol01501)

• Name: hsa-mir-488 ,Homo sapiens
• Synonyms: microRNA 488
• Molecule Type: Precursor miRNA
• Gene Name: MIR488
• Gene ID: 574441
• Location: chr1:177029363-177029445[-]
• Sequence:
  GAGAAUCAUCUCUCCCAGAUAAUGGCACUCUCAAACAAGUUUCCAAAUUGUUUGAAAGGC
  UAUUUCUUGGUCAGAUGACUCUC
• Ensembl ID: ENSG00000202609
• HGNC ID: HGNC:32073
• Precursor Accession: MI0003123

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: NER signaling pathway; Activation; hsa03420
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: Sk-MES-1 cells; Lung; Homo sapiens (Human); CVCL_0630
• In Vitro Model: A549/DDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Cell Titer 96 AQueous One Solution Assay; Annexin V FITC Apoptosis assay; Clone formation assay
• Mechanism Description: miRNA-488 inhibited eIF3a expression by directly binding to the 3'UTR of eIF3a, the overexpression of miRNA-488 inhibited cell migration and invasion in A549 cells, and also inhibited cell proliferation, cell cycle progression by elevated P27 expression. The mechanism of miRNA-488 induced cisplatin resistance was that miRNA-488 activated nucleotide excision repair (NER) by increasing the expression of Replication Protein A (RPA) 14 and Xeroderma pigmentosum group C (XPC).

References

• Ref 1: MiR-488 inhibits proliferation and cisplatin sensibility in non-small-cell lung cancer (NSCLC) cells by activating the eIF3a-mediated NER signaling pathway. Sci Rep. 2017 Jan 11;7:40384. doi: 10.1038/srep40384.