General Information of the Molecule (ID: Mol01482)
Name
hsa-mir-340 ,Homo sapiens
Synonyms
microRNA 340
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR340
Gene ID
442908
Location
chr5:180015303-180015397[-]
Sequence
UUGUACCUGGUGUGAUUAUAAAGCAAUGAGACUGAUUGUCAUAUGUCGUUUGUGGGAUCC
GUCUCAGUUACUUUAUAGCCAUACCUGGUAUCUUA
    Click to Show/Hide
Ensembl ID
ENSG00000198995
HGNC ID
HGNC:31777
Precursor Accession
MI0000802
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [1]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
Experiment for
Molecule Alteration
PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Overexpression of ZEB1 reversed the miR-340-induced alleviation of chemoresistance in drug-resistant OS cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [2]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Nrf2 signaling pathway Activation hsa05208
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Bioinformatics analysis and luciferase assays ofNrf2-3'-untranslated region-based reporter constructor indicated that Nrf2 was the direct target gene of miR-340, miR-340 mimics suppressing Nrf2-dependent antioxidant pathway and enhancing the sensitivity of HepG2/CDDP cells to cisplatin. Interestingly, transfection with miR-340 mimics combined with miR-340 inhibitorsreactivated the Nrf2 related pathway and restored the resistance of HepG2/CDDP cells to CDDP. Collectively,the results first suggested that lower expression of miR-340 is involved in the development of CDDP resistancein hepatocellular carcinoma cell line, at least partly due to regulating Nrf2-dependent antioxidant pathway.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Docetaxel
Molecule Alteration Expression
.
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model TOV21G cells Ovary Homo sapiens (Human) CVCL_3613
TOV112D cells Ovary Homo sapiens (Human) CVCL_3612
C13 cells Ovary Homo sapiens (Human) CVCL_0114
OV2008 cells Ovary Homo sapiens (Human) CVCL_0473
A2780CP cells Ovary Homo sapiens (Human) CVCL_0135
A2780s cells Ovary Homo sapiens (Human) CVCL_4863
IGROV1 cells Ovary Homo sapiens (Human) CVCL_1304
OVCAR5 cells Ovary Homo sapiens (Human) CVCL_1628
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
Experiment for
Molecule Alteration
miRNA probe assay
Experiment for
Drug Resistance
Cell proliferation assays
Mechanism Description MicroRNAs (miRNAs) are 19 to 25-nucleotide, non-coding, RNA transcripts, thought to be instrumental in controlling eukaryotic cell function via modulation of post-transcriptional activity of multiple target mRNA genes by repression of translation or regulation of mRNA degradation.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [4]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
NCM460 cells Colon Homo sapiens (Human) CVCL_0460
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis
Mechanism Description The ectopic overexpression of miR340 in CRC cell lines resulted in growth inhibition, apoptosis and enhanced chemosensitivity in vitro and in vivo, which was mediated by directly targeting RLIP76.
References
Ref 1 miR-340 alleviates chemoresistance of osteosarcoma cells by targeting ZEB1. Anticancer Drugs. 2018 Jun;29(5):440-448. doi: 10.1097/CAD.0000000000000614.
Ref 2 miR-340 reverses cisplatin resistance of hepatocellular carcinoma cell lines by targeting Nrf2-dependent antioxidant pathway. Asian Pac J Cancer Prev. 2014;15(23):10439-44. doi: 10.7314/apjcp.2014.15.23.10439.
Ref 3 Sequential development of mutant clones in an imatinib resistant chronic myeloid leukaemia patient following sequential treatment with multiple tyrosine kinase inhibitors: an emerging problem . Cancer Chemother Pharmacol. 2009 Jun;64(1):195-7. doi: 10.1007/s00280-008-0905-5. Epub 2009 Jan 21.
Ref 4 miR-340 suppresses tumor growth and enhances chemosensitivity of colorectal cancer by targeting RLIP76. Eur Rev Med Pharmacol Sci. 2017 Jun;21(12):2875-2886.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.