Molecule Information
General Information of the Molecule (ID: Mol01476)
| Name |
hsa-mir-378
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 378a
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR378A
|
||||
| Gene ID | |||||
| Location |
chr5:149732825-149732890[+]
|
||||
| Sequence |
AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUAGAAAUAGCACUGGACUUGGAGUCAGA
AGGCCU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] | [1] | |||
| Sensitive Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Anip973 cells | Lung | Homo sapiens (Human) | CVCL_6879 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Altered expression of miR-378 in human lung adenocarcinoma cell lines with varying sensitivities to cDDP, and have shown that miR-378 can restore cDDP chemosensitivity in the human lung adenocarcinoma cells by targeting sCLU and downregulating Bcl-2, pCas-3, pErk1/2 and pAkt. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Liver cancer [ICD-11: 2C12.6] | [2] | |||
| Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
| Sensitive Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| MAPK signaling pathway | Inhibition | hsa04010 | ||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR 378a enhances the sensitivity of liver cancer to sorafenib by targeting VEGFR, PDGFRbeta and c Raf. Sorafenib can suppress tumor growth through the inhibition of multiple tyrosine kinases, including VEGFR, PDGFRbeta and c-Raf. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
