Molecule Information

General Information of the Molecule (ID: Mol01459)

• Name: hsa-mir-34c ,Homo sapiens
• Synonyms: microRNA 34c
• Molecule Type: Precursor miRNA
• Gene Name: MIR34C
• Gene ID: 407042
• Location: chr11:111513439-111513515[+]
• Sequence:
  AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACAC
  GGCCAGGUAAAAAGAUU
• Ensembl ID: ENSG00000207562
• HGNC ID: HGNC:31637
• Precursor Accession: MI0000743

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [1]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: BCL2/cyclin D1 signaling pathway; Inhibition; hsa04210
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: HOS cells; Bone; Homo sapiens (Human); CVCL_0312
• In Vitro Model: 143B cells; Bone; Homo sapiens (Human); CVCL_2270
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: The miR-34c inhibitor restored the BCL-2 and cyclin D1 levels in MG63 and HOS cell line, which implicated that NEAT1 inhibited the tumor suppressor miR-34c and up-regulated cell survival signals for the development of OS.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: p53-mediated apoptosis pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Erlotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [3]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Erlotinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Serotonin receptor signalling; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• Experiment for Molecule Alteration: High-throughput miRNA analysis
• Experiment for Drug Resistance: Sulforhodamine-B assay
• Mechanism Description: Expression of 13 miRNA genes predicts response to EGFR inhibition in cancer cell lines and tumours, and discriminates primary from metastatic tumours. Signature genes target proteins that are enriched for epithelial-to-mesenchymal transition (EMT) genes. Epithelial-to-mesenchymal transition predicts EGFR inhibitor resistance and metastatic behaviour. The EMT transcription factor, ZEB1, shows altered expression in erlotinib-sensitive NSCLC and PDAC, where many signature miRNA genes are upregulated. Ectopic expression of mir-200c alters expression of EMT proteins, sensitivity to erlotinib, and migration in lung cells. Treatment with TGFbeta1 changes expression of signature miRNA and EMT proteins and modulates migration in lung cells.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [4]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Differential gene expression between parental and gemcitabine-resistant pancreatic cancer cell. Consequently, compared with SW1990 cells, 28 microRNAs were upregulated and 28 microRNAs were decreased (fold change>=2) in SW1990/GEM cells. Then, the expression of some differential microRNAs was confirmed by Q-PCR assays. We found that miR-643, miR-1261, miR483-5p, miR-371a-5p, and miR-373-3p were upregulated and that the expression of miR-4455, miR-3676, miR-4650, miR4791, and miR-4644 was decreased in SW1990/GEM cells. Generally, the tendency of expression changes was consistent between microRNA-seq and Q-PCR results.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [5]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Caspase-3 activity assay
• Mechanism Description: Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [6]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MG-63 cells; Bone; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Luciferase reporter assay
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Studies have shown that miR-34c is associated with metastasis and the chemoresponse of several cancers, but its role in osteosarcoma (OS) is unclear

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [7]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay and flow cytometry
• Mechanism Description: We demonstrate that Bmf (Bcl-2-modifying factor) is a target of miR-34c-5p, and that its silencing, together with that of c-myc, a known target of miR-34c-5p, contributes to resistance to apoptosis induced by paclitaxel through p53 downregulation.

References

• Ref 1: Knockdown of the oncogene lncRNA NEAT1 restores the availability of miR-34c and improves the sensitivity to cisplatin in osteosarcoma. Biosci Rep. 2018 May 31;38(3):BSR20180375. doi: 10.1042/BSR20180375. Print 2018 Jun 29.
• Ref 2: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 3: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 4: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 5: MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
• Ref 6: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 7: Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.