Molecule Information
General Information of the Molecule (ID: Mol01459)
| Name |
hsa-mir-34c
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 34c
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR34C
|
||||
| Gene ID | |||||
| Location |
chr11:111513439-111513515[+]
|
||||
| Sequence |
AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACAC
GGCCAGGUAAAAAGAUU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | BCL2/cyclin D1 signaling pathway | Inhibition | hsa04210 | |
| Cell apoptosis | Activation | hsa04210 | ||
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| HOS cells | Bone | Homo sapiens (Human) | CVCL_0312 | |
| 143B cells | Bone | Homo sapiens (Human) | CVCL_2270 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | The miR-34c inhibitor restored the BCL-2 and cyclin D1 levels in MG63 and HOS cell line, which implicated that NEAT1 inhibited the tumor suppressor miR-34c and up-regulated cell survival signals for the development of OS. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
