Molecule Information

General Information of the Molecule (ID: Mol01459)

• Name: hsa-mir-34c ,Homo sapiens
• Synonyms: microRNA 34c
• Molecule Type: Precursor miRNA
• Gene Name: MIR34C
• Gene ID: 407042
• Location: chr11:111513439-111513515[+]
• Sequence:
  AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACAC
  GGCCAGGUAAAAAGAUU
• Ensembl ID: ENSG00000207562
• HGNC ID: HGNC:31637
• Precursor Accession: MI0000743

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: BCL2/cyclin D1 signaling pathway; Inhibition; hsa04210
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: HOS cells; Bone; Homo sapiens (Human); CVCL_0312
• In Vitro Model: 143B cells; Bone; Homo sapiens (Human); CVCL_2270
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: The miR-34c inhibitor restored the BCL-2 and cyclin D1 levels in MG63 and HOS cell line, which implicated that NEAT1 inhibited the tumor suppressor miR-34c and up-regulated cell survival signals for the development of OS.

References

• Ref 1: Knockdown of the oncogene lncRNA NEAT1 restores the availability of miR-34c and improves the sensitivity to cisplatin in osteosarcoma. Biosci Rep. 2018 May 31;38(3):BSR20180375. doi: 10.1042/BSR20180375. Print 2018 Jun 29.