Molecule Information

General Information of the Molecule (ID: Mol01445)
Name
hsa-mir-186 ,Homo sapiens
Synonyms
microRNA 186
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR186
Gene ID
406962
Location
chr1:71067631-71067716[-]
Sequence
UGCUUGUAACUUUCCAAAGAAUUCUCCUUUUGGGCUUUCUGGUUUUAUUUUAAGCCCAAA
GGUGAAUUUUUUGGGAAGUUUGAGCU
    Click to Show/Hide
Ensembl ID
ENSG00000207721
HGNC ID
HGNC:31557
Precursor Accession
MI0000483
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell proliferation Activation hsa05200
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
AGS cells Gastric Homo sapiens (Human) CVCL_0139
SGC-7921 cells Gastric Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration		 Luciferase reporter assay
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The long noncoding RNA PVT1 functions as a competing endogenous RNA by sponging miR186 in gastric cancer.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [2]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model LN229 cells Brain Homo sapiens (Human) CVCL_0393
U87MG cells Brain Homo sapiens (Human) CVCL_GP63
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR 186 reverses cisplatin resistance and inhibits the formation of the GIC phenotype by degrading YY1 in glioblastoma.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description Both A2780/DDP and A2780/Taxol cells expressed miR-186 at lower levels than A2780. miR-186 overexpression increased the sensitivity of ovarian cancer cell lines to paclitaxel and cisplatin compared with the negative control or mock cells, miR-186 transfection induced cell apoptosis while anti-miR-186 transfection reduced cell apoptosis, suggesting that miR-186 may inhibit the development of drug resistance in ovarian cancer cells. miR-186 overexpression may increase the sensitivity of ovarian cancer cells to paclitaxel by targeting ABCB1 and modulating GST-Pi.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [4]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
Experiment for
Drug Resistance		 CellTiter-Blue Cell Viability Assay (Promega)
Mechanism Description Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.
Methotrexate
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [5]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Methotrexate
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HCT-8 cells Colon Homo sapiens (Human) CVCL_2478
HT-29-R cells Colon Homo sapiens (Human) CVCL_6834
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometric analysis
Mechanism Description TUG1 mediates methotrexate resistance in colorectal cancer via miR186/CPEB2 axis. TUG1 might worked as a ceRNA to sponge miR186, TUG1 mediated MTX resistance in CRC cells via suppressing miR186.
Mitomycin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [6]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Resistant Drug Mitomycin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 Microarray analysis; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [7]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation p53 signaling pathway Activation hsa04115
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
H1975 cells Lung Homo sapiens (Human) CVCL_1511
A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
H4006 cells Lung Homo sapiens (Human) N.A.
293FT cells Kidney Homo sapiens (Human) CVCL_6911
HCC95 cells Lung Homo sapiens (Human) CVCL_5137
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CellTiter-Glo assay
Mechanism Description miR186 regulates chemo-sensitivity to paclitaxel via targeting MAPT in non-small cell lung cancer The chemosensitizing effects of miR186 are partially due to the induction of the p53 mediated apoptotic pathway via MAPT down-regulation.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description Both A2780/DDP and A2780/Taxol cells expressed miR-186 at lower levels than A2780. miR-186 overexpression increased the sensitivity of ovarian cancer cell lines to paclitaxel and cisplatin compared with the negative control or mock cells, miR-186 transfection induced cell apoptosis while anti-miR-186 transfection reduced cell apoptosis, suggesting that miR-186 may inhibit the development of drug resistance in ovarian cancer cells. miR-186 overexpression may increase the sensitivity of ovarian cancer cells to paclitaxel by targeting ABCB1 and modulating GST-Pi.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [8]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Verapamil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [6]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 Microarray analysis; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.
References
Ref 1 The long noncoding RNA PVT1 functions as a competing endogenous RNA by sponging miR-186 in gastric cancer. Biomed Pharmacother. 2017 Apr;88:302-308. doi: 10.1016/j.biopha.2017.01.049. Epub 2017 Feb 24.
Ref 2 miR-186 reverses cisplatin resistance and inhibits the formation of the glioblastoma-initiating cell phenotype by degrading Yin Yang 1 in glioblastoma. Int J Mol Med. 2019 Jan;43(1):517-524. doi: 10.3892/ijmm.2018.3940. Epub 2018 Oct 18.
Ref 3 MicroRNA-186 induces sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1. J Ovarian Res. 2015 Dec 2;8:80. doi: 10.1186/s13048-015-0207-6.
Ref 4 Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
Ref 5 TUG1 mediates methotrexate resistance in colorectal cancer via miR-186/CPEB2 axis. Biochem Biophys Res Commun. 2017 Sep 16;491(2):552-557. doi: 10.1016/j.bbrc.2017.03.042. Epub 2017 Mar 14.
Ref 6 Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
Ref 7 miR-186 regulates chemo-sensitivity to paclitaxel via targeting MAPT in non-small cell lung cancer (NSCLC). Mol Biosyst. 2016 Oct 18;12(11):3417-3424. doi: 10.1039/c6mb00576d.
Ref 8 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.