Molecule Information
General Information of the Molecule (ID: Mol01440)
| Name |
hsa-mir-136
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 136
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR136
|
||||
| Gene ID | |||||
| Location |
chr14:100884702-100884783[+]
|
||||
| Sequence |
UGAGCCCUCGGAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAUGCUCCAUCAUCGUCUC
AAAUGAGUCUUCAGAGGGUUCU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] | [1] | |||
| Resistant Disease | Prolactin-secreting adenoma [ICD-11: 2F37.Y] | |||
| Resistant Drug | Bromocriptine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | KHM-5M cells | Pleural effusion | Homo sapiens (Human) | CVCL_2975 |
| Experiment for Molecule Alteration |
Solexa sequencing assay; qRT-PCR | |||
| Experiment for Drug Resistance |
Clinical diagnostic evaluation | |||
| Mechanism Description | Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] | [2] | |||
| Resistant Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 |
| Experiment for Molecule Alteration |
qRT-PCR; RT-PCR | |||
| Experiment for Drug Resistance |
Trypan blue staining assay; Flow cytometry assay | |||
| Mechanism Description | miR-136 may function as an anti-oncogene and deficiency of miR-136 expression in ovarian cancer can induce chemoresistance at least in part by downregulating apoptosis and promoting the repair of cisplatin-induced DNA damage. Thus, miR-136 may provide a biomarker for predicting the chemosensitivity to cisplatin in patients with epithelial ovarian cancer. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [3] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
WST assay; Spheroid formation assay; Colony-forming assay; TUNEL assay; Wound healing assay | |||
| Mechanism Description | microRNA-136 inhibits cancer stem cell activity and enhances the anti-tumor effect of paclitaxel against chemoresistant ovarian cancer cells by targeting Notch3. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] | [4] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.0] | |||
| Resistant Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 | |
| Experiment for Molecule Alteration |
RT-PCR; Western blot; Luciferase assay | |||
| Experiment for Drug Resistance |
Cytotoxicity assay; Apoptosis assays | |||
| Mechanism Description | Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
