Molecule Information

General Information of the Molecule (ID: Mol01440)

• Name: hsa-mir-136 ,Homo sapiens
• Synonyms: microRNA 136
• Molecule Type: Precursor miRNA
• Gene Name: MIR136
• Gene ID: 406927
• Location: chr14:100884702-100884783[+]
• Sequence:
  UGAGCCCUCGGAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAUGCUCCAUCAUCGUCUC
  AAAUGAGUCUUCAGAGGGUUCU
• Ensembl ID: ENSG00000207942
• HGNC ID: HGNC:31522
• Precursor Accession: MI0000475

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Bromocriptine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [1]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Bromocriptine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: KHM-5M cells; Pleural effusion; Homo sapiens (Human); CVCL_2975
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: Clinical diagnostic evaluation
• Mechanism Description: Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epithelial ovarian cancer [2]

• Resistant Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• Experiment for Molecule Alteration: qRT-PCR; RT-PCR
• Experiment for Drug Resistance: Trypan blue staining assay; Flow cytometry assay
• Mechanism Description: miR-136 may function as an anti-oncogene and deficiency of miR-136 expression in ovarian cancer can induce chemoresistance at least in part by downregulating apoptosis and promoting the repair of cisplatin-induced DNA damage. Thus, miR-136 may provide a biomarker for predicting the chemosensitivity to cisplatin in patients with epithelial ovarian cancer.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [3]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST assay; Spheroid formation assay; Colony-forming assay; TUNEL assay; Wound healing assay
• Mechanism Description: microRNA-136 inhibits cancer stem cell activity and enhances the anti-tumor effect of paclitaxel against chemoresistant ovarian cancer cells by targeting Notch3.

References

• Ref 1: MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
• Ref 2: Expression of miR-136 is associated with the primary cisplatin resistance of human epithelial ovarian cancer. Oncol Rep. 2015 Feb;33(2):591-8. doi: 10.3892/or.2014.3640. Epub 2014 Dec 2.
• Ref 3: MicroRNA-136 inhibits cancer stem cell activity and enhances the anti-tumor effect of paclitaxel against chemoresistant ovarian cancer cells by targeting Notch3. Cancer Lett. 2017 Feb 1;386:168-178. doi: 10.1016/j.canlet.2016.11.017. Epub 2016 Nov 22.