General Information of the Molecule (ID: Mol01440)
Name
hsa-mir-136 ,Homo sapiens
Synonyms
microRNA 136
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR136
Gene ID
406927
Location
chr14:100884702-100884783[+]
Sequence
UGAGCCCUCGGAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAUGCUCCAUCAUCGUCUC
AAAUGAGUCUUCAGAGGGUUCU
    Click to Show/Hide
Ensembl ID
ENSG00000207942
HGNC ID
HGNC:31522
Precursor Accession
MI0000475
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bromocriptine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] [1]
Resistant Disease Prolactin-secreting adenoma [ICD-11: 2F37.Y]
Resistant Drug Bromocriptine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model KHM-5M cells Pleural effusion Homo sapiens (Human) CVCL_2975
Experiment for
Molecule Alteration
Solexa sequencing assay; qRT-PCR
Experiment for
Drug Resistance
Clinical diagnostic evaluation
Mechanism Description Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [2]
Resistant Disease Epithelial ovarian cancer [ICD-11: 2B5D.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model OV2008 cells Ovary Homo sapiens (Human) CVCL_0473
Experiment for
Molecule Alteration
qRT-PCR; RT-PCR
Experiment for
Drug Resistance
Trypan blue staining assay; Flow cytometry assay
Mechanism Description miR-136 may function as an anti-oncogene and deficiency of miR-136 expression in ovarian cancer can induce chemoresistance at least in part by downregulating apoptosis and promoting the repair of cisplatin-induced DNA damage. Thus, miR-136 may provide a biomarker for predicting the chemosensitivity to cisplatin in patients with epithelial ovarian cancer.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
WST assay; Spheroid formation assay; Colony-forming assay; TUNEL assay; Wound healing assay
Mechanism Description microRNA-136 inhibits cancer stem cell activity and enhances the anti-tumor effect of paclitaxel against chemoresistant ovarian cancer cells by targeting Notch3.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [4]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
Resistant Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration
RT-PCR; Western blot; Luciferase assay
Experiment for
Drug Resistance
Cytotoxicity assay; Apoptosis assays
Mechanism Description Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.
References
Ref 1 MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
Ref 2 Expression of miR-136 is associated with the primary cisplatin resistance of human epithelial ovarian cancer. Oncol Rep. 2015 Feb;33(2):591-8. doi: 10.3892/or.2014.3640. Epub 2014 Dec 2.
Ref 3 MicroRNA-136 inhibits cancer stem cell activity and enhances the anti-tumor effect of paclitaxel against chemoresistant ovarian cancer cells by targeting Notch3. Cancer Lett. 2017 Feb 1;386:168-178. doi: 10.1016/j.canlet.2016.11.017. Epub 2016 Nov 22.
Ref 4 Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.