Molecule Information

General Information of the Molecule (ID: Mol01436)

• Name: hsa-mir-125b-2 ,Homo sapiens
• Synonyms: microRNA 125b-2
• Molecule Type: Precursor miRNA
• Gene Name: MIR125B2
• Gene ID: 406912
• Location: chr21:16590237-16590325[+]
• Sequence:
  ACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUAUUUUAGUAACAUCACAAG
  UCAGGCUCUUGGGACCUAGGCGGAGGGGA
• Ensembl ID: ENSG00000207863
• HGNC ID: HGNC:31507
• Precursor Accession: MI0000470

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [1]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Mitochondrial apoptotic signaling pathway; Inhibition; hsa04210
• In Vitro Model: Human glioblastoma tissues and PRGMTTT samples; Brain; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-125b-2 is overexpressed in glioblastoma multiforme tissues and the corresponding stem cells (GBMSC); downregulation of miR-125b-2 expression in GBMSC could allow TMZ to induce GBMSC apoptosis. Additionally, the expression of the anti-apop-totic protein Bcl-2 was decreased after the TMZ+miR-125b-2 inhibitor treatment, while the expression of the proapoptotic protein Bax was increased. he induction of apoptosis in GBMSC is also associated with increased cytochrome c release from mitochondria, induction of Apaf-1, activation of caspase-3 and poly-ADP-ribose polymerase (PARP). miR-125b-2 overexpression might confer glioblastoma stem cells resistance to TMZ.

References

• Ref 1: MicroRNA-125b-2 confers human glioblastoma stem cells resistance to temozolomide through the mitochondrial pathway of apoptosis. Int J Oncol. 2012 Jan;40(1):119-29. doi: 10.3892/ijo.2011.1179. Epub 2011 Aug 29.