General Information of the Molecule (ID: Mol01430)
Name
hsa-mir-144 ,Homo sapiens
Synonyms
microRNA 144
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR144
Gene ID
406936
Location
chr17:28861533-28861618[-]
Sequence
UGGGGCCCUGGCUGGGAUAUCAUCAUAUACUGUAAGUUUGCGAUGAGACACUACAGUAUA
GAUGAUGUACUAGUCCGGGCACCCCC
    Click to Show/Hide
Ensembl ID
ENSG00000283819
HGNC ID
HGNC:31531
Precursor Accession
MI0000460
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bromocriptine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] [1]
Resistant Disease Prolactin-secreting adenoma [ICD-11: 2F37.Y]
Resistant Drug Bromocriptine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model KHM-5M cells Pleural effusion Homo sapiens (Human) CVCL_2975
Experiment for
Molecule Alteration
Solexa sequencing assay; qRT-PCR
Experiment for
Drug Resistance
Clinical diagnostic evaluation
Mechanism Description Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Anaplastic thyroid carcinoma [ICD-11: 2D10.3] [2]
Sensitive Disease Anaplastic thyroid carcinoma [ICD-11: 2D10.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model TPC-1 cells Thyroid Homo sapiens (Human) CVCL_6298
ARO cells Thyroid Homo sapiens (Human) CVCL_0144
HTori3 cell Thyroid Homo sapiens (Human) CVCL_4W02
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay; TUNEL assay
Mechanism Description miR-144 could inhibit autophagy of ATC cells by down-regulating TGF-alpha, enhancing the cisplatin-sensitivity of ATC cells.
Imatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [3]
Sensitive Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Sensitive Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description c-Myc expression was upregulated in the imatinib resistant k562R cells, which in turn increased the expression of miR-144/451, restoration of miR-144/451 or knockdown of Myc could sensitize the imatinib resistant cells to apoptosis. Myc, miR-144/451 form a regulatory pathway and contribute to the imatinib resistance.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [4]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model U87MG cells Brain Homo sapiens (Human) CVCL_GP63
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
Colorimetric SRB assay
Mechanism Description The increase of miR-144 levels, shown to be downregulated in U87 and DBTRG human GB cell lines, as well as in GB tumor samples, promoted the downregulation of mRNA of enzymes involved in bioenergetic pathways, with consequent alterations in cell metabolism, impairment of migratory capacity, and sensitization of DBTRG cells to a chemotherapeutic drug, the dichloroacetate (DCA).
Dichloroacetate
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [4]
Resistant Disease Glioblastoma [ICD-11: 2A00.02]
Resistant Drug Dichloroacetate
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model DBTRG cells Brain Homo sapiens (Human) CVCL_1169
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Colorimetric SRB assay
Mechanism Description The potential of miR-144 overexpression to reduce GB cell malignancy, both by decreasing Cell migration and invasion abilities and by sensitizing resistant tumor cells to chemotherapy, paving the way to a novel and more effective GB therapy.
References
Ref 1 MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
Ref 2 Effects of miR-144 on the sensitivity of human anaplastic thyroid carcinoma cells to cisplatin by autophagy regulation. Cancer Biol Ther. 2018 Jun 3;19(6):484-496. doi: 10.1080/15384047.2018.1433502. Epub 2018 Mar 26.
Ref 3 Myc induced miR-144/451 contributes to the acquired imatinib resistance in chronic myelogenous leukemia cell K562. Biochem Biophys Res Commun. 2012 Aug 24;425(2):368-73. doi: 10.1016/j.bbrc.2012.07.098. Epub 2012 Jul 27.
Ref 4 MiR-144 overexpression as a promising therapeutic strategy to overcome glioblastoma cell invasiveness and resistance to chemotherapy. Hum Mol Genet. 2019 Aug 15;28(16):2738-2751. doi: 10.1093/hmg/ddz099.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.