Molecule Information
General Information of the Molecule (ID: Mol01430)
Name |
hsa-mir-144
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 144
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR144
|
||||
Gene ID | |||||
Location |
chr17:28861533-28861618[-]
|
||||
Sequence |
UGGGGCCCUGGCUGGGAUAUCAUCAUAUACUGUAAGUUUGCGAUGAGACACUACAGUAUA
GAUGAUGUACUAGUCCGGGCACCCCC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prolactin-secreting adenoma | [1] | |||
Resistant Disease | Prolactin-secreting adenoma [ICD-11: 2F37.Y] | |||
Resistant Drug | Bromocriptine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | KHM-5M cells | Pleural effusion | Homo sapiens (Human) | CVCL_2975 |
Experiment for Molecule Alteration |
Solexa sequencing assay; qRT-PCR | |||
Experiment for Drug Resistance |
Clinical diagnostic evaluation | |||
Mechanism Description | Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Anaplastic thyroid carcinoma | [2] | |||
Sensitive Disease | Anaplastic thyroid carcinoma [ICD-11: 2D10.3] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | TPC-1 cells | Thyroid | Homo sapiens (Human) | CVCL_6298 |
ARO cells | Thyroid | Homo sapiens (Human) | CVCL_0144 | |
HTori3 cell | Thyroid | Homo sapiens (Human) | CVCL_4W02 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay; TUNEL assay | |||
Mechanism Description | miR-144 could inhibit autophagy of ATC cells by down-regulating TGF-alpha, enhancing the cisplatin-sensitivity of ATC cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Chronic myeloid leukemia | [3] | |||
Sensitive Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
Sensitive Drug | Imatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | c-Myc expression was upregulated in the imatinib resistant k562R cells, which in turn increased the expression of miR-144/451, restoration of miR-144/451 or knockdown of Myc could sensitize the imatinib resistant cells to apoptosis. Myc, miR-144/451 form a regulatory pathway and contribute to the imatinib resistance. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [4] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell migration | Inhibition | hsa04670 | ||
In Vitro Model | U87MG cells | Brain | Homo sapiens (Human) | CVCL_GP63 |
Experiment for Molecule Alteration |
Western blotting analysis | |||
Experiment for Drug Resistance |
Colorimetric SRB assay | |||
Mechanism Description | The increase of miR-144 levels, shown to be downregulated in U87 and DBTRG human GB cell lines, as well as in GB tumor samples, promoted the downregulation of mRNA of enzymes involved in bioenergetic pathways, with consequent alterations in cell metabolism, impairment of migratory capacity, and sensitization of DBTRG cells to a chemotherapeutic drug, the dichloroacetate (DCA). |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [4] | |||
Resistant Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Resistant Drug | Dichloroacetate | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell migration | Activation | hsa04670 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | DBTRG cells | Brain | Homo sapiens (Human) | CVCL_1169 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Colorimetric SRB assay | |||
Mechanism Description | The potential of miR-144 overexpression to reduce GB cell malignancy, both by decreasing Cell migration and invasion abilities and by sensitizing resistant tumor cells to chemotherapy, paving the way to a novel and more effective GB therapy. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.