General Information of the Molecule (ID: Mol01411)
Name
hsa-mir-23b ,Homo sapiens
Synonyms
microRNA 23b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR23B
Gene ID
407011
Location
chr9:95085208-95085304[+]
Sequence
CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUC
ACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC
    Click to Show/Hide
Ensembl ID
ENSG00000207563
HGNC ID
HGNC:31606
Precursor Accession
MI0000439
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Endometrial carcinoma [ICD-11: 2C76.2] [1]
Sensitive Disease Endometrial carcinoma [ICD-11: 2C76.2]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model HEC1A cells Uterus Homo sapiens (Human) CVCL_0293
Human normal endometrial epithelial cell line Uterus Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
RNA pull-down assay; qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis
Mechanism Description Long non-coding RNA TUSC7 acted as a potential tumor suppressor gene to inhibit cell growth as well as advance the chemotherapy sensitivity through targeted silencing of miR23b.
Disease Class: Chondrosarcoma [ICD-11: 2B50.0] [2]
Sensitive Disease Chondrosarcoma [ICD-11: 2B50.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Src/AKT signaling pathway Inhibition hsa04917
In Vitro Model CH-2879 cells Bone Homo sapiens (Human) CVCL_9921
OUMS-27 cells Bone Homo sapiens (Human) CVCL_3090
SW1353 cells Bone Homo sapiens (Human) CVCL_0543
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Transwell invasion assay
Mechanism Description Src kinase is a direct target of miR23b in chondrosarcoma cells, overexpression of miR23b suppresses Src-Akt pathway, leading to the sensitization of cisplatin resistant chondrosarcoma cells to cisplatin.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Endometrial carcinoma [ICD-11: 2C76.2] [1]
Sensitive Disease Endometrial carcinoma [ICD-11: 2C76.2]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model HEC1A cells Uterus Homo sapiens (Human) CVCL_0293
Human normal endometrial epithelial cell line Uterus Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
RNA pull-down assay; qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis
Mechanism Description Long non-coding RNA TUSC7 acted as a potential tumor suppressor gene to inhibit cell growth as well as advance the chemotherapy sensitivity through targeted silencing of miR23b.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [3]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model U87 GSCs Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-23b overexpression sensitized U87 glioma stem cells to TMZ-induced growth inhibition. And miR-23b had a synergistically suppressive effect on the expression of HMGA2 with TMZ in U87 GSCs.
References
Ref 1 Long non-coding RNA tumor suppressor candidate 7 advances chemotherapy sensitivity of endometrial carcinoma through targeted silencing of miR-23b. Tumour Biol. 2017 Jun;39(6):1010428317707883. doi: 10.1177/1010428317707883.
Ref 2 Inhibition of Src by microRNA-23b increases the cisplatin sensitivity of chondrosarcoma cells. Cancer Biomark. 2017;18(3):231-239. doi: 10.3233/CBM-160102.
Ref 3 Methylation mediated silencing of miR-23b expression and its role in glioma stem cells. Neurosci Lett. 2012 Oct 24;528(2):185-9. doi: 10.1016/j.neulet.2012.08.055. Epub 2012 Sep 5.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.