Molecule Information

General Information of the Molecule (ID: Mol01411)

• Name: hsa-mir-23b ,Homo sapiens
• Synonyms: microRNA 23b
• Molecule Type: Precursor miRNA
• Gene Name: MIR23B
• Gene ID: 407011
• Location: chr9:95085208-95085304[+]
• Sequence:
  CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUC
  ACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC
• Ensembl ID: ENSG00000207563
• HGNC ID: HGNC:31606
• Precursor Accession: MI0000439

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.0]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• Experiment for Molecule Alteration: RT-PCR; Luciferase reporter assay; Western blot; Immunohistochemistry; Microarrays assay
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: In this report, we investigated the exact roles and mechanisms of miR-23b-3p in the MDR of GC

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Endometrial carcinoma [ICD-11: 2C76.2] [3]

• Sensitive Disease: Endometrial carcinoma [ICD-11: 2C76.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HEC1A cells; Uterus; Homo sapiens (Human); CVCL_0293
• In Vitro Model: Human normal endometrial epithelial cell line; Uterus; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RNA pull-down assay; qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: Long non-coding RNA TUSC7 acted as a potential tumor suppressor gene to inhibit cell growth as well as advance the chemotherapy sensitivity through targeted silencing of miR23b.

Disease Class: Chondrosarcoma [ICD-11: 2B50.0] [4]

• Sensitive Disease: Chondrosarcoma [ICD-11: 2B50.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Src/AKT signaling pathway; Inhibition; hsa04917
• In Vitro Model: CH-2879 cells; Bone; Homo sapiens (Human); CVCL_9921
• In Vitro Model: OUMS-27 cells; Bone; Homo sapiens (Human); CVCL_3090
• In Vitro Model: SW1353 cells; Bone; Homo sapiens (Human); CVCL_0543
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Transwell invasion assay
• Mechanism Description: Src kinase is a direct target of miR23b in chondrosarcoma cells, overexpression of miR23b suppresses Src-Akt pathway, leading to the sensitization of cisplatin resistant chondrosarcoma cells to cisplatin.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [6]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MRP-1/ABCC1; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR; Luciferase reporter assay; Western blot; Immunofluorescence staining
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Seventeen of miRNAs were differentially expressed in MCF-7/VP cells and their parent cells. The majority of these miRNAs exhibited increased expression levels, while miR-326, miR-429, miR-187, miR-7, and miR-92-2 showed decreased expression.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Endometrial carcinoma [ICD-11: 2C76.2] [3]

• Sensitive Disease: Endometrial carcinoma [ICD-11: 2C76.2]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HEC1A cells; Uterus; Homo sapiens (Human); CVCL_0293
• In Vitro Model: Human normal endometrial epithelial cell line; Uterus; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RNA pull-down assay; qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: Long non-coding RNA TUSC7 acted as a potential tumor suppressor gene to inhibit cell growth as well as advance the chemotherapy sensitivity through targeted silencing of miR23b.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [ICD-11: 2A00.1] [7]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: U87 GSCs; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-23b overexpression sensitized U87 glioma stem cells to TMZ-induced growth inhibition. And miR-23b had a synergistically suppressive effect on the expression of HMGA2 with TMZ in U87 GSCs.

References

• Ref 1: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 2: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 3: Long non-coding RNA tumor suppressor candidate 7 advances chemotherapy sensitivity of endometrial carcinoma through targeted silencing of miR-23b. Tumour Biol. 2017 Jun;39(6):1010428317707883. doi: 10.1177/1010428317707883.
• Ref 4: Inhibition of Src by microRNA-23b increases the cisplatin sensitivity of chondrosarcoma cells. Cancer Biomark. 2017;18(3):231-239. doi: 10.3233/CBM-160102.
• Ref 5: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 6: Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24. doi: 10.1016/j.bcp.2009.10.017. Epub 2009 Oct 31.
• Ref 7: Methylation mediated silencing of miR-23b expression and its role in glioma stem cells. Neurosci Lett. 2012 Oct 24;528(2):185-9. doi: 10.1016/j.neulet.2012.08.055. Epub 2012 Sep 5.