Molecule Information

General Information of the Molecule (ID: Mol01409)
Name
hsa-let-7i ,Homo sapiens
Synonyms
microRNA let-7i
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIRLET7I
Gene ID
406891
Location
chr12:62603686-62603769[+]
Sequence
CUGGCUGAGGUAGUAGUUUGUGCUGUUGGUCGGGUUGUGACAUUGCCCGCUGUGGAGAUA
ACUGCGCAAGCUACUGCCUUGCUA
    Click to Show/Hide
Ensembl ID
ENSG00000199179
HGNC ID
HGNC:31486
Precursor Accession
MI0000434
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]
Resistant Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Panc1 cells Pancreas Homo sapiens (Human) CVCL_0480
In Vivo Model 4 to 6-week-old female non-obese mice with diabetes/severe combined immunodeficiency Mus musculus
Experiment for
Molecule Alteration		 Immunohistochemistry; qRT-PCR
Experiment for
Drug Resistance		 Cell viability assays
Mechanism Description The in vitro drug sensitivity of pancreatic cancer cells was altered according to the miR-1246 expression via CCNG2.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Reduced let-7i expression significantly increased the resistance of ovarian and breast cancer cells to the chemotherapy drug, cis-platinum.
Disease Class: Cervical cancer [ICD-11: 2C77.0] [2]
Resistant Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Reduced let-7i expression significantly increased the resistance of ovarian and breast cancer cells to the chemotherapy drug, cis-platinum.
Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [2]
Resistant Disease Epithelial ovarian cancer [ICD-11: 2B5D.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
OVCAR10 cells Ovary Homo sapiens (Human) CVCL_4377
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Reduced let-7i expression significantly increased the resistance of ovarian and breast cancer cells to the chemotherapy drug, cis-platinum.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [3]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/DDP cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometric analysis; TUNEL assay; MTT assay; Colony formation assay
Mechanism Description LncRNA XIST overexpression in A549 cells increased their chemosensitivity to cisplatin both in vitro and in vivo by protecting cells from apoptosis and promoting cell proliferation. XIST functioned as competing endogenous RNA to repress let-7i, which controlled its down-stream target BAG-1.
Disease Class: Esophageal carcinoma [ICD-11: 2B70.4] [4]
Sensitive Disease Esophageal carcinoma [ICD-11: 2B70.4]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model EC109 cells Esophagus Homo sapiens (Human) CVCL_6898
HEEpiC cells Esophagus Homo sapiens (Human) N.A.
TE10 cells Esophagus Homo sapiens (Human) CVCL_1760
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description ABCC10, a drug resistance gene, was identified as a functional and direct target gene of miR-let-7g/i. Luciferase reporter assay confirmed that let-7g and let-7i combined directly with 3'UTR of ABCC10, in consequence, inhibiting ABCC10 expression and enhancing cellular sensitivity to drugs.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [5]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation RAS/RAF/MAPK signalling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
Experiment for
Drug Resistance		 CellTiter-Blue Cell Viability Assay (Promega)
Mechanism Description Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [6]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model J82 cells Bladder Homo sapiens (Human) CVCL_0359
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
RT4 cells Bladder Homo sapiens (Human) CVCL_0036
RT112 cells Bladder Homo sapiens (Human) CVCL_1670
Experiment for
Molecule Alteration		 Western blot; Microarray Analysis; qRT-PCR
Experiment for
Drug Resistance		 Proliferation Assay
Mechanism Description Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [7]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Resistant Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTS assay; Flow cytometric analysis; CFU assay
Mechanism Description miR224 and let-7i regulate the proliferation and chemosensitivity of CML cells probably via targeting ST3GAL IV.
Paclitaxel
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [8]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model OVCAR-3 cells Ascites Homo sapiens (Human) CVCL_0465
Experiment for
Molecule Alteration		 Western blot
Experiment for
Drug Resistance		 Flow cytometry; MTT assay; Clonogenic assay
Mechanism Description The purpose of this study was to establish tumor tissue specific delivery of let-7i miRNA to reverse paclitaxel-induced chemoresistance. A chimera that combines MUC1 aptamer and let-7i miRNA was tested in OVCAR-3 ovarian cancer cells. Results demonstrated that the chimera can specifically be delivered into OVCAR-3 cells and the released let-7i significantly sensitized the role of paclitaxel in inhibiting cell proliferation, inducing cell apoptosis, and decreasing long-term cell survival. The chimera achieved reversal of chemoresistance through downregulation of cyclin D1, cyclin D2, Dicer 1, and PGRMC1 expressions. Our study indicated that this MUC1/let-7i chimera can specifically reverse chemoresistance to paclitaxel.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [9]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ER-alpha 36 mediated nongenomic estrogen signaling pathway Activation hsa04915
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
ZR75-1 cells Breast Homo sapiens (Human) CVCL_0588
MDA-MB-436 cells Breast Homo sapiens (Human) CVCL_0623
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
184A1 cells Breast Homo sapiens (Human) CVCL_3040
HB3396 cells Breast Homo sapiens (Human) N.A.
MEGM cells Breast Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Breast cancer patients with tumors highly expressing ER-alpha36 benefit less from tamoxifen treatment. Both mRNA and protein expression of ER-alpha36 were inhibited by let-7 mimics and enhanced by let-7 inhibitors. Our results suggested a novel regulatory mechanism of let-7 miRNAs on ER-alpha36 mediated nongenomic estrogen signal pathways and Tam resistance.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [9]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ER-alpha 36 mediated nongenomic estrogen signaling pathway Inhibition hsa04915
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
ZR75-1 cells Breast Homo sapiens (Human) CVCL_0588
MDA-MB-436 cells Breast Homo sapiens (Human) CVCL_0623
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
184A1 cells Breast Homo sapiens (Human) CVCL_3040
HB3396 cells Breast Homo sapiens (Human) N.A.
MEGM cells Breast Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Let-7 miRNAs (b and i) enhanced tamoxifen sensitivity of tamoxifen-resistant breast cancer cells by targeting ER-alpha36 expression.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [10]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Verapamil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
References
Ref 1 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 2 MicroRNA microarray identifies Let-7i as a novel biomarker and therapeutic target in human epithelial ovarian cancer. Cancer Res. 2008 Dec 15;68(24):10307-14. doi: 10.1158/0008-5472.CAN-08-1954.
Ref 3 LncRNA XIST promotes human lung adenocarcinoma cells to cisplatin resistance via let-7i/BAG-1 axis. Cell Cycle. 2017;16(21):2100-2107. doi: 10.1080/15384101.2017.1361071. Epub 2017 Sep 29.
Ref 4 BAG3-mediated miRNA let-7g and let-7i inhibit proliferation and enhance apoptosis of human esophageal carcinoma cells by targeting the drug transporter ABCC10. Cancer Lett. 2016 Feb 1;371(1):125-33. doi: 10.1016/j.canlet.2015.11.031. Epub 2015 Dec 3.
Ref 5 Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
Ref 6 The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
Ref 7 Downregulation of miR-224 and let-7i contribute to cell survival and chemoresistance in chronic myeloid leukemia cells by regulating ST3GAL IV expression. Gene. 2017 Aug 30;626:106-118. doi: 10.1016/j.gene.2017.05.030. Epub 2017 May 13.
Ref 8 Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
Ref 9 let-7 microRNAs induce tamoxifen sensitivity by downregulation of estrogen receptor Alpha signaling in breast cancer. Mol Med. 2011;17(11-12):1233-41. doi: 10.2119/molmed.2010.00225. Epub 2011 Jul 27.
Ref 10 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.