Molecule Information

General Information of the Molecule (ID: Mol01402)

• Name: hsa-mir-218-2 ,Homo sapiens
• Synonyms: microRNA 218-2
• Molecule Type: Precursor miRNA
• Gene Name: MIR218-2
• Gene ID: 407001
• Location: chr5:168768146-168768255[-]
• Sequence:
  GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAA
  ACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA
• Ensembl ID: ENSG00000207739
• HGNC ID: HGNC:31596
• Precursor Accession: MI0000295

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Clinical Trial Drug(s) 1 drug(s) in total

Beta-lapachone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [1]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Beta-lapachone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: U118 cells; Brain; Homo sapiens (Human); CVCL_0633
• In Vitro Model: HA-1800 cells; Brain; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Soft agar colony formation assay; Wound-healing analysis
• Mechanism Description: miR218-2 promotes glioblastomas growth, invasion and drug resistance by targeting CDC27, and the overexpression of CDC27 counteracted the function of miR218-2 in glioma cells. miR218-2 induces glioma malig.ncy by targeting CDC27, which leads to a decrease in the activation of the APC/C biquitin-proteosome pathway, probably downstream of the TGFbeta signaling pathways.

References

• Ref 1: mir-218-2 promotes glioblastomas growth, invasion and drug resistance by targeting CDC27. Oncotarget. 2017 Jan 24;8(4):6304-6318. doi: 10.18632/oncotarget.13850.