Molecule Information

General Information of the Molecule (ID: Mol01398)
Name
hsa-mir-215 ,Homo sapiens
Synonyms
microRNA 215
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR215
Gene ID
406997
Location
chr1:220117853-220117962[-]
Sequence
AUCAUUCAGAAAUGGUAUACAGGAAAAUGACCUAUGAAUUGACAGACAAUAUAGCUGAGU
UUGUCUGUCAUUUCUUUAGGCCAAUAUUCUGUAUGACUGUGCUACUUCAA
    Click to Show/Hide
Ensembl ID
ENSG00000207590
HGNC ID
HGNC:31592
Precursor Accession
MI0000291
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Rectal cancer [ICD-11: 2B92.0] [1]
Resistant Disease Rectal cancer [ICD-11: 2B92.0]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration		 Gene expression profiling assay
Mechanism Description MiR-215, miR-190b and miR-29b-2* have been overexpressed in non-responders, and let-7e, miR-196b, miR-450a, miR-450b-5p and miR-99a* have shown higher expression levels in responders
Capecitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Rectal cancer [ICD-11: 2B92.0] [1]
Resistant Disease Rectal cancer [ICD-11: 2B92.0]
 Disease Info 
Resistant Drug Capecitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration		 Gene expression profiling assay
Mechanism Description MiR-215, miR-190b and miR-29b-2* have been overexpressed in non-responders, and let-7e, miR-196b, miR-450a, miR-450b-5p and miR-99a* have shown higher expression levels in responders
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
Experiment for
Molecule Alteration		 RT-qPCR
Mechanism Description This gene is down-regulated in cisplatin-resistance cells
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [3]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR; Luciferase assay
Experiment for
Drug Resistance		 Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is down-regulated in doxorubicin-sensitive cells
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [3]
Sensitive Disease Renal cell carcinoma [ICD-11: 2C90.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR; Luciferase assay
Experiment for
Drug Resistance		 Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is down-regulated in doxorubicin-sensitive cells
Methotrexate
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [4]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Methotrexate
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 WST-1 assay
Mechanism Description miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.
Disease Class: Colon cancer [ICD-11: 2B90.1] [4]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Methotrexate
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 WST-1 assay
Mechanism Description miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.
Paclitaxel
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [5]
Sensitive Disease Epithelial ovarian cancer [ICD-11: 2B5D.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
CAOV3 cells Ovary Homo sapiens (Human) CVCL_0201
SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
HEY cells Ovary Homo sapiens (Human) CVCL_0297
Experiment for
Molecule Alteration		 Real-time PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description mRNA expression of miR-215 was significantly decreased in EOC tissues and cell lines. Upregulation of miR-215 inhibited cell proliferation, promoted apoptosis and increased sensitivity to chemotherapy drugs in EOC cells. In contrast, downregulation of miR-215 increased cell proliferation, inhibited apoptosis and decreased sensitivity to chemotherapy drugs in EOC cells. In addition, the X-chromosome-linked inhibitor of apoptosis (XIAP) expression was significantly increased in EOC tissues and cell lines. Downregulation of XIAP inhibited cell proliferation, promoted apoptosis and increased sensitivity to chemotherapy drugs in EOC cells. Upregulation of miR-215 notably inhibited the expression of XIAP. Moreover, overexpression of XIAP significantly inhibited miR-215-exerted decrease of proliferation, increase of apoptosis and increase of sensitivity to chemotherapy drugs.
Raltitrexed
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [4]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Raltitrexed
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 WST-1 assay
Mechanism Description miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.
Disease Class: Colon cancer [ICD-11: 2B90.1] [4]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Raltitrexed
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 WST-1 assay
Mechanism Description miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.
References
Ref 1 Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
Ref 2 BGB-283, a Novel RAF Kinase and EGFR Inhibitor, Displays Potent Antitumor Activity in BRAF-Mutated Colorectal CancersMol Cancer Ther. 2015 Oct;14(10):2187-97. doi: 10.1158/1535-7163.MCT-15-0262. Epub 2015 Jul 24.
Ref 3 The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
Ref 4 Molecular mechanism of chemoresistance by miR-215 in osteosarcoma and colon cancer cells. Mol Cancer. 2010 Apr 30;9:96. doi: 10.1186/1476-4598-9-96.
Ref 5 Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.