Molecule Information
General Information of the Molecule (ID: Mol01398)
Name |
hsa-mir-215
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 215
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR215
|
||||
Gene ID | |||||
Location |
chr1:220117853-220117962[-]
|
||||
Sequence |
AUCAUUCAGAAAUGGUAUACAGGAAAAUGACCUAUGAAUUGACAGACAAUAUAGCUGAGU
UUGUCUGUCAUUUCUUUAGGCCAAUAUUCUGUAUGACUGUGCUACUUCAA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Methotrexate | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
p53 signaling pathway | Activation | hsa04115 | ||
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
WST-1 assay | |||
Mechanism Description | miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX. | |||
Disease Class: Colon cancer | [1] | |||
Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
Resistant Drug | Methotrexate | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
p53 signaling pathway | Activation | hsa04115 | ||
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
WST-1 assay | |||
Mechanism Description | miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Raltitrexed | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
p53 signaling pathway | Activation | hsa04115 | ||
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
WST-1 assay | |||
Mechanism Description | miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX. | |||
Disease Class: Colon cancer | [1] | |||
Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
Resistant Drug | Raltitrexed | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
p53 signaling pathway | Activation | hsa04115 | ||
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
WST-1 assay | |||
Mechanism Description | miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.