General Information of the Molecule (ID: Mol01398)
Name
hsa-mir-215 ,Homo sapiens
Synonyms
microRNA 215
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR215
Gene ID
406997
Location
chr1:220117853-220117962[-]
Sequence
AUCAUUCAGAAAUGGUAUACAGGAAAAUGACCUAUGAAUUGACAGACAAUAUAGCUGAGU
UUGUCUGUCAUUUCUUUAGGCCAAUAUUCUGUAUGACUGUGCUACUUCAA
    Click to Show/Hide
Ensembl ID
ENSG00000207590
HGNC ID
HGNC:31592
Precursor Accession
MI0000291
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Methotrexate
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Methotrexate
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
WST-1 assay
Mechanism Description miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.
Disease Class: Colon cancer [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Methotrexate
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
WST-1 assay
Mechanism Description miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.
Raltitrexed
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Raltitrexed
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
WST-1 assay
Mechanism Description miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.
Disease Class: Colon cancer [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Raltitrexed
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
WST-1 assay
Mechanism Description miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.
References
Ref 1 Molecular mechanism of chemoresistance by miR-215 in osteosarcoma and colon cancer cells. Mol Cancer. 2010 Apr 30;9:96. doi: 10.1186/1476-4598-9-96.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.