Molecule Information
General Information of the Molecule (ID: Mol01369)
Name |
hsa-mir-196a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 196a-1
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR196A1
|
||||
Gene ID | |||||
Location |
chr17:48632490-48632559[-]
|
||||
Sequence |
GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAACACAACAACAUUAAACCA
CCCGAUUCAC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Head and neck cancer | [1] | |||
Resistant Disease | Head and neck cancer [ICD-11: 2D42.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell colony | Activation | hsa05200 | ||
Cell viability | Activation | hsa05200 | ||
In Vitro Model | SCC25 cells | Oral | Homo sapiens (Human) | CVCL_1682 |
CAL-27 cells | Tongue | Homo sapiens (Human) | CVCL_1107 | |
293T cells | Breast | Homo sapiens (Human) | CVCL_0063 | |
SCC4 cells | Tongue | Homo sapiens (Human) | CVCL_1684 | |
SCC9 cells | Tongue | Homo sapiens (Human) | CVCL_1685 | |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Exosomal miR-196a promotes cisplatin resistance in HNC cells through CDkN1B and ING5 downregulation. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [2] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 | |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
NCI-H1650 cells | Lung | Homo sapiens (Human) | CVCL_1483 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-196a was upregulated in human NSCLC tissues and cell lines; the downregulation of miR-196a (+) the sensitivity of NSCLC cell lines (SPC-A-1, A549) to DDP through the induction of apoptosis by targeting homeobox A5 (HOXA5). Taken together, these findings suggest that miR-196a is a valid therapeutic target with the potential to be employed as a novel multimodality therapy as part of a strategy for the treatment of patients with NSCLC. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.