Molecule Information

General Information of the Molecule (ID: Mol01369)

• Name: hsa-mir-196a ,Homo sapiens
• Synonyms: microRNA 196a-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR196A1
• Gene ID: 406972
• Location: chr17:48632490-48632559[-]
• Sequence:
  GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAACACAACAACAUUAAACCA
  CCCGAUUCAC
• Ensembl ID: ENSG00000210741
• HGNC ID: HGNC:31567
• Precursor Accession: MI0000238

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Head and neck cancer [1]

• Resistant Disease: Head and neck cancer [ICD-11: 2D42.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: SCC25 cells; Oral; Homo sapiens (Human); CVCL_1682
• In Vitro Model: CAL-27 cells; Tongue; Homo sapiens (Human); CVCL_1107
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• In Vitro Model: SCC4 cells; Tongue; Homo sapiens (Human); CVCL_1684
• In Vitro Model: SCC9 cells; Tongue; Homo sapiens (Human); CVCL_1685
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Exosomal miR-196a promotes cisplatin resistance in HNC cells through CDkN1B and ING5 downregulation.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H1650 cells; Lung; Homo sapiens (Human); CVCL_1483
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-196a was upregulated in human NSCLC tissues and cell lines; the downregulation of miR-196a (+) the sensitivity of NSCLC cell lines (SPC-A-1, A549) to DDP through the induction of apoptosis by targeting homeobox A5 (HOXA5). Taken together, these findings suggest that miR-196a is a valid therapeutic target with the potential to be employed as a novel multimodality therapy as part of a strategy for the treatment of patients with NSCLC.

References

• Ref 1: Exosomal miR-196a derived from cancer-associated fibroblasts confers cisplatin resistance in head and neck cancer through targeting CDKN1B and ING5. Genome Biol. 2019 Jan 14;20(1):12. doi: 10.1186/s13059-018-1604-0.
• Ref 2: Downregulation of microRNA-196a enhances the sensitivity of non-small cell lung cancer cells to cisplatin treatment. Int J Mol Med. 2016 Apr;37(4):1067-74. doi: 10.3892/ijmm.2016.2513. Epub 2016 Mar 1.