Molecule Information

General Information of the Molecule (ID: Mol01366)

• Name: hsa-mir-105 ,Homo sapiens
• Synonyms: microRNA 105-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR105-1
• Gene ID: 406897
• Location: chrX:152392219-152392299[-]
• Sequence:
  UGUGCAUCGUGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUCAUGCACCACGGAUGUUU
  GAGCAUGUGCUACGGUGUCUA
• Ensembl ID: ENSG00000207957
• HGNC ID: HGNC:31492
• Precursor Accession: MI0000111

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Activation; hsa04310
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: AU565 cells; Breast; Homo sapiens (Human); CVCL_1074
• In Vitro Model: BT-483 cells; Breast; Homo sapiens (Human); CVCL_2319
• In Vitro Model: BT549 cells; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: DU4475 cells; Breast; Homo sapiens (Human); CVCL_1183
• In Vitro Model: HCC1599 cells; Breast; Homo sapiens (Human); CVCL_1256
• In Vitro Model: HCC1806 cells; Breast; Homo sapiens (Human); CVCL_1258
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• In Vitro Model: HCC70 cells; Breast; Homo sapiens (Human); CVCL_1270
• In Vitro Model: Hs-578T cells; Breast; Homo sapiens (Human); CVCL_0332
• In Vitro Model: MB-361 cells; Breast; Homo sapiens (Human); CVCL_0620
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR105/93-3p activates Wnt/beta-catenin signaling by downregulating SFRP1 and thereby promotes stemness, chemoresistance, and metastasis in TNBC cells.

References

• Ref 1: miR-105/93-3p promotes chemoresistance and circulating miR-105/93-3p acts as a diagnostic biomarker for triple negative breast cancer. Breast Cancer Res. 2017 Dec 19;19(1):133. doi: 10.1186/s13058-017-0918-2.