Molecule Information
General Information of the Molecule (ID: Mol01366)
| Name |
hsa-mir-105
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 105-1
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR105-1
|
||||
| Gene ID | |||||
| Location |
chrX:152392219-152392299[-]
|
||||
| Sequence |
UGUGCAUCGUGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUCAUGCACCACGGAUGUUU
GAGCAUGUGCUACGGUGUCUA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Wnt/Beta-catenin signaling pathway | Activation | hsa04310 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| AU565 cells | Breast | Homo sapiens (Human) | CVCL_1074 | |
| BT-483 cells | Breast | Homo sapiens (Human) | CVCL_2319 | |
| BT549 cells | Breast | Homo sapiens (Human) | CVCL_1092 | |
| DU4475 cells | Breast | Homo sapiens (Human) | CVCL_1183 | |
| HCC1599 cells | Breast | Homo sapiens (Human) | CVCL_1256 | |
| HCC1806 cells | Breast | Homo sapiens (Human) | CVCL_1258 | |
| HCC1937 cells | Breast | Homo sapiens (Human) | CVCL_0290 | |
| HCC70 cells | Breast | Homo sapiens (Human) | CVCL_1270 | |
| Hs-578T cells | Breast | Homo sapiens (Human) | CVCL_0332 | |
| MB-361 cells | Breast | Homo sapiens (Human) | CVCL_0620 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR105/93-3p activates Wnt/beta-catenin signaling by downregulating SFRP1 and thereby promotes stemness, chemoresistance, and metastasis in TNBC cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
