Molecule Information
General Information of the Molecule (ID: Mol01365)
Name |
hsa-mir-103
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 103a-1
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR103A1
|
||||
Gene ID | |||||
Location |
chr5:168560896-168560973[-]
|
||||
Sequence |
UACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUAC
AGGGCUAUGAAGGCAUUG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Cervical cancer | [1] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Lung cancer | [1] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | PEO1 C4-2 cells | Ovary | Homo sapiens (Human) | N.A. |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Cervical cancer | [1] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Lung cancer | [1] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | PEO1 C4-2 cells | Ovary | Homo sapiens (Human) | N.A. |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. |
Clinical Trial Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Sensitive Drug | Camptothecin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Camptothecin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Cervical cancer | [1] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Camptothecin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Lung cancer | [1] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Camptothecin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Camptothecin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | PEO1 C4-2 cells | Ovary | Homo sapiens (Human) | N.A. |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.