General Information of the Molecule (ID: Mol01365)
Name
hsa-mir-103 ,Homo sapiens
Synonyms
microRNA 103a-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR103A1
Gene ID
406895
Location
chr5:168560896-168560973[-]
Sequence
UACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUAC
AGGGCUAUGAAGGCAUUG
    Click to Show/Hide
Ensembl ID
ENSG00000199035
HGNC ID
HGNC:31490
Precursor Accession
MI0000109
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Breast cancer [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Cervical cancer [1]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Lung cancer [1]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Ovarian cancer [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model PEO1 C4-2 cells Ovary Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Breast cancer [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Cervical cancer [1]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Lung cancer [1]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Ovarian cancer [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model PEO1 C4-2 cells Ovary Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Camptothecin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Camptothecin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Breast cancer [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Camptothecin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Cervical cancer [1]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Camptothecin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Lung cancer [1]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Camptothecin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Ovarian cancer [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Camptothecin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model PEO1 C4-2 cells Ovary Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
References
Ref 1 Systematic screen identifies miRNAs that target RAD51 and RAD51D to enhance chemosensitivity. Mol Cancer Res. 2013 Dec;11(12):1564-73. doi: 10.1158/1541-7786.MCR-13-0292. Epub 2013 Oct 2.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.