Molecule Information
General Information of the Molecule (ID: Mol01365)
| Name |
hsa-mir-103
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 103a-1
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR103A1
|
||||
| Gene ID | |||||
| Location |
chr5:168560896-168560973[-]
|
||||
| Sequence |
UACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUAC
AGGGCUAUGAAGGCAUUG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [1] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [1] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [1] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | PEO1 C4-2 cells | Ovary | Homo sapiens (Human) | N.A. |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [1] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [1] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [1] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | PEO1 C4-2 cells | Ovary | Homo sapiens (Human) | N.A. |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [1] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [1] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [1] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | PEO1 C4-2 cells | Ovary | Homo sapiens (Human) | N.A. |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
