Molecule Information
General Information of the Molecule (ID: Mol01346)
Name |
hsa-mir-24
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 24-1
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR24-1
|
||||
Gene ID | |||||
Location |
chr9:95086021-95086088[+]
|
||||
Sequence |
CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUACACACUGGCUCAGUUCAGCAGG
AACAGGAG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | FIH1/HIFalpha signaling pathway | Regulation | hsa04066 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
BT549 cells | Breast | Homo sapiens (Human) | CVCL_1092 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Caspase-Glo 3/7 Assay; Transwell migration assay | |||
Mechanism Description | miR24 increases under hypoxic conditions, causing downregulation of FIH1 and upregulation of HIF1alpha. miR24 hampers chemotherapy-induced apoptosis in breast CSCs and increases cell resistance to hypoxic conditions through an FIH1 HIFalpha pathway. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast carcinoma | [2] | |||
Sensitive Disease | Breast carcinoma [ICD-11: 2C60.2] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; TUNEL assay | |||
Mechanism Description | Overexpression of microRNA-24 increases the sensitivity to paclitaxel in drug-resistant breast carcinoma cell lines via targeting ABCB9. | |||
Disease Class: Endometrial carcinoma | [3] | |||
Sensitive Disease | Endometrial carcinoma [ICD-11: 2C76.2] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
In Vitro Model | HEC-1A cells | Uterus | Homo sapiens (Human) | CVCL_0293 |
In Vivo Model | Crl:NU-Foxn1nu nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-24, which is under-expressed in EC, functions as a tumor-suppressing gene to inhibit malignant proliferation and advance chemotherapy sensitivity to paclitaxel in EC by targeted silencing of S100A8. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.