Molecule Information

General Information of the Molecule (ID: Mol01335)

• Name: hsa-mir-15a ,Homo sapiens
• Synonyms: microRNA 15a
• Molecule Type: Precursor miRNA
• Gene Name: MIR15A
• Gene ID: 406948
• Location: chr13:50049119-50049201[-]
• Sequence:
  CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAU
  UGUGCUGCCUCAAAAAUACAAGG
• Ensembl ID: ENSG00000283785
• HGNC ID: HGNC:31543
• Precursor Accession: MI0000069

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 16 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• Experiment for Molecule Alteration: MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
• Experiment for Drug Resistance: Cell proliferation assay; Flow cytometry
• Mechanism Description: We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.

Bortezomib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Multiple myeloma [ICD-11: 2A83.0] [2]

• Resistant Disease: Multiple myeloma [ICD-11: 2A83.0]
• Resistant Drug: Bortezomib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Multiple myeloma patients; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay and flow cytometry
• Mechanism Description: BMSCs suppress the proliferation of myeloma cells and regulate the drug sensitivity of myeloma cells through the inhibited expression of miRNA-15a/-16.IL-6 plays a pivotal role in the occurrence of drug resistance.

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [3]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: RT-qPCR
• Mechanism Description: Objective To compare morphological differences of three drug-resistant hepatocellular carcinoma (HCC) cell subclones (Huh-7/ADM,Huh-7/CBP,Huh-7/MMC) and their parental Huh-7 cell line,to analyze differential microRNA(miRNA) expression profiles in these cells and,finally to screen for the abnormal expressed miRNAs in drug-resistant HCC cells. Increased expression of hsa-mir-15a.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [4]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [4]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

Dexamethasone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Multiple myeloma [ICD-11: 2A83.0] [5]

• Resistant Disease: Multiple myeloma [ICD-11: 2A83.0]
• Resistant Drug: Dexamethasone
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U266 cells; Bone marrow; Homo sapiens (Human); CVCL_0566
• In Vitro Model: NCI-H929 cells; Bone marrow; Homo sapiens (Human); CVCL_1600
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry
• Mechanism Description: In conclusion, our data suggest that via suppressing miRNA-15a and -16 expressions, IL-6 secreted by BMSCs promotes drug-resistance in myeloma cells.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [6]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Global microRNA profiling was performed on docetaxel-resistant and sensitive cell lines to identify candidate circulating microRNA biomarkers. Custom Taqman Array MicroRNA cards were used to measure the levels of 46 candidate microRNAs in plasma/serum samples, collected before and after docetaxel treatment, from 97 CRPC patients. Expression of hsa-mir-15a is increased.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [7]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [8]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Immunoblot analysis; Fluorescence In Situ Hybridization (FISH) analysis; cDNA microarray; RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: HTLA-ER cells, following etoposide exposure, evaded apoptosis by altering Bax/Bcl2 ratio. While both cell populations shared a homozygous TP53 mutation encoding a partially-functioning protein, a mono-allelic deletion of 13q14.3 locus, where the P53 inducible miRNAs 15a/16-1 are located, and the consequent miRNA down-regulation were detected only in HTLA-ER cells. This event correlated with BMI-1 oncoprotein up-regulation which caused a decrease in p16 tumor suppressor content and a metabolic adaptation of HTLA-ER cells.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [2]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay; MTT assay
• Mechanism Description: The present study identifies a series of miRNAs which were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues. Down-regulation of expression of gene hsa-mir-15a

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [9]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Caspase-3 activity assay
• Mechanism Description: Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.

Melphalan

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Multiple myeloma [ICD-11: 2A83.0] [5]

• Resistant Disease: Multiple myeloma [ICD-11: 2A83.0]
• Resistant Drug: Melphalan
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U266 cells; Bone marrow; Homo sapiens (Human); CVCL_0566
• In Vitro Model: NCI-H929 cells; Bone marrow; Homo sapiens (Human); CVCL_1600
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry
• Mechanism Description: In conclusion, our data suggest that via suppressing miRNA-15a and -16 expressions, IL-6 secreted by BMSCs promotes drug-resistance in myeloma cells.

Mitomycin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [3]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Mitomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: RT-qPCR
• Mechanism Description: Objective To compare morphological differences of three drug-resistant hepatocellular carcinoma (HCC) cell subclones (Huh-7/ADM,Huh-7/CBP,Huh-7/MMC) and their parental Huh-7 cell line,to analyze differential microRNA(miRNA) expression profiles in these cells and,finally to screen for the abnormal expressed miRNAs in drug-resistant HCC cells. Increased expression of hsa-mir-15a.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [11]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: NU/NU immune compromised mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase reporter assay
• Experiment for Drug Resistance: Apoptosis assay; Cell proliferation assay
• Mechanism Description: In addition, HER2 16 expression results in suppression of BCL-2-targeting microRNAs miR-15a and miR-16

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [12]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [13]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: NCr-nu athymic nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR; luciferase reporter assay; Western blot; Immunohistology analysis
• Experiment for Drug Resistance: Apoptosis assay; CCK8 assay

Vinorelbine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [4]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Vinorelbine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [4]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Vinorelbine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

References

• Ref 1: Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
• Ref 2: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 3: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 4: Tumour suppressor microRNAs contribute to drug resistance in malignant pleural mesothelioma by targeting anti-apoptotic pathways .Cancer Drug Resist. 2019 Dec 19;2(4):1193-1206. doi: 10.20517/cdr.2019.41. eCollection 2019. 10.20517/cdr.2019.41
• Ref 5: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 6: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 7: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 8: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 9: MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
• Ref 10: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 11: Phase II trial of gefitinib and everolimus in advanced non-small cell lung cancer. J Thorac Oncol. 2010 Oct;5(10):1623-9. doi: 10.1097/JTO.0b013e3181ec1531.
• Ref 12: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 13: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.