General Information of the Molecule (ID: Mol01335)
Name
hsa-mir-15a ,Homo sapiens
Synonyms
microRNA 15a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR15A
Gene ID
406948
Location
chr13:50049119-50049201[-]
Sequence
CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAU
UGUGCUGCCUCAAAAAUACAAGG
    Click to Show/Hide
Ensembl ID
ENSG00000283785
HGNC ID
HGNC:31543
Precursor Accession
MI0000069
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant pleural mesothelioma [1]
Resistant Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
SYBR Green-based assay
Mechanism Description Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.
Disease Class: Malignant pleural mesothelioma [1]
Resistant Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
SYBR Green-based assay
Mechanism Description Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.
Vinorelbine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant pleural mesothelioma [1]
Resistant Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
Resistant Drug Vinorelbine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
SYBR Green-based assay
Mechanism Description Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.
Disease Class: Malignant pleural mesothelioma [1]
Resistant Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
Resistant Drug Vinorelbine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
SYBR Green-based assay
Mechanism Description Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.
References
Ref 1 Tumour suppressor microRNAs contribute to drug resistance in malignant pleural mesothelioma by targeting anti-apoptotic pathways .Cancer Drug Resist. 2019 Dec 19;2(4):1193-1206. doi: 10.20517/cdr.2019.41. eCollection 2019. 10.20517/cdr.2019.41
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.