Molecule Information

General Information of the Molecule (ID: Mol01335)

• Name: hsa-mir-15a ,Homo sapiens
• Synonyms: microRNA 15a
• Molecule Type: Precursor miRNA
• Gene Name: MIR15A
• Gene ID: 406948
• Location: chr13:50049119-50049201[-]
• Sequence:
  CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAU
  UGUGCUGCCUCAAAAAUACAAGG
• Ensembl ID: ENSG00000283785
• HGNC ID: HGNC:31543
• Precursor Accession: MI0000069

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [1]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

Disease Class: Malignant pleural mesothelioma [1]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

Vinorelbine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [1]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Vinorelbine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

Disease Class: Malignant pleural mesothelioma [1]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Vinorelbine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

References

• Ref 1: Tumour suppressor microRNAs contribute to drug resistance in malignant pleural mesothelioma by targeting anti-apoptotic pathways .Cancer Drug Resist. 2019 Dec 19;2(4):1193-1206. doi: 10.20517/cdr.2019.41. eCollection 2019. 10.20517/cdr.2019.41