Molecule Information
General Information of the Molecule (ID: Mol01333)
| Name |
hsa-let-7f-1
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA let-7f-1
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIRLET7F1
|
||||
| Gene ID | |||||
| Location |
chr9:94176347-94176433[+]
|
||||
| Sequence |
UCAGAGUGAGGUAGUAGAUUGUAUAGUUGUGGGGUAGUGAUUUUACCCUGUUCAGGAGAU
AACUAUACAAUCUAUUGCCUUCCCUGA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Medulloblastoma [ICD-11: 2A00.10] | [1] | |||
| Resistant Disease | Medulloblastoma [ICD-11: 2A00.10] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | D425 cells | Brain | Homo sapiens (Human) | CVCL_1275 |
| UW228 cells | Brain | Homo sapiens (Human) | CVCL_8585 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay; TUNEL assay | |||
| Mechanism Description | High-Mobility Group Box 1 (HMGB1) is a direct target of miR-let-7f-1. HMGB1 is a highly conserved nuclear protein that functions as a chromatin-binding factor that bends DNA and promotes access to transcriptional protein assemblies on specific DNA targets. Overexpression of HMGB1 in cells treated with pSP and cisplatin blocked SPARC-induced cisplatin resistance indicating that overexpression of miR-let-7f-1 and a reduction in HMGB1 protein levels result in cellular resistance to cisplatin in SPARC over expressed cells. Earlier studies demonstrated that HMGB1 functions as a regulator of the balance between autophagy and apoptosis. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
