Molecule Information

General Information of the Molecule (ID: Mol01333)

• Name: hsa-let-7f-1 ,Homo sapiens
• Synonyms: microRNA let-7f-1
• Molecule Type: Precursor miRNA
• Gene Name: MIRLET7F1
• Gene ID: 406888
• Location: chr9:94176347-94176433[+]
• Sequence:
  UCAGAGUGAGGUAGUAGAUUGUAUAGUUGUGGGGUAGUGAUUUUACCCUGUUCAGGAGAU
  AACUAUACAAUCUAUUGCCUUCCCUGA
• Ensembl ID: ENSG00000199072
• HGNC ID: HGNC:31483
• Precursor Accession: MI0000067

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Medulloblastoma [ICD-11: 2A00.10] [2]

• Resistant Disease: Medulloblastoma [ICD-11: 2A00.10]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: D425 cells; Brain; Homo sapiens (Human); CVCL_1275
• In Vitro Model: UW228 cells; Brain; Homo sapiens (Human); CVCL_8585
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay; TUNEL assay
• Mechanism Description: High-Mobility Group Box 1 (HMGB1) is a direct target of miR-let-7f-1. HMGB1 is a highly conserved nuclear protein that functions as a chromatin-binding factor that bends DNA and promotes access to transcriptional protein assemblies on specific DNA targets. Overexpression of HMGB1 in cells treated with pSP and cisplatin blocked SPARC-induced cisplatin resistance indicating that overexpression of miR-let-7f-1 and a reduction in HMGB1 protein levels result in cellular resistance to cisplatin in SPARC over expressed cells. Earlier studies demonstrated that HMGB1 functions as a regulator of the balance between autophagy and apoptosis.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [3]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: EMT; Regulation; N.A.
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• In Vitro Model: COLO357 cells; Pancreas; Homo sapiens (Human); CVCL_0221
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: HPAC cells; Pancreas; Homo sapiens (Human); CVCL_3517
• Experiment for Molecule Alteration: RT-qPCR; Western blot; Immunofluorescence staining
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: Differential expression of let-7 and miR-200 in gemcitabine-sensitive and resistant pancreatic cancer cells treated with B-DIM or G2535 tested by miRNA array. The expression of hsa-let-7f-1 is decreased in drug-resistant cells.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: miR-let-7f-1 regulates SPARC mediated cisplatin resistance in medulloblastoma cells. Cell Signal. 2014 Oct;26(10):2193-201. doi: 10.1016/j.cellsig.2014.06.014. Epub 2014 Jul 8.
• Ref 3: Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 2009 Aug 15;69(16):6704-12. doi: 10.1158/0008-5472.CAN-09-1298. Epub 2009 Aug 4.