Molecule Information

General Information of the Molecule (ID: Mol01773)
Name
hsa-miR-6825-5p ,Homo sapiens
Synonyms
microRNA 6825
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGGGAGGUGUGGAGUCAGCAU
    Click to Show/Hide
Ensembl ID
ENSG00000275067
HGNC ID
HGNC:50208
Mature Accession
MIMAT0027550
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
PLC cells Liver Homo sapiens (Human) CVCL_0485
L02 cells Liver Homo sapiens (Human) CVCL_6926
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR6825-5p, miR6845-5p and miR6886-3p could decrease the level of USP22 protein by binding to the 3'-untranlated region of USP22 mRNA. All the three microRNAs (miRNAs) were downregulated by HULC, which resulted in the elevation of USP22. The pathway 'HULC/USP22/Sirt1/ protective autophagy' attenuates the sensitivity of HCC cells to chemotherapeutic agents.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
PLC cells Liver Homo sapiens (Human) CVCL_0485
L02 cells Liver Homo sapiens (Human) CVCL_6926
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR6825-5p, miR6845-5p and miR6886-3p could decrease the level of USP22 protein by binding to the 3'-untranlated region of USP22 mRNA. All the three microRNAs (miRNAs) were downregulated by HULC, which resulted in the elevation of USP22. The pathway 'HULC/USP22/Sirt1/ protective autophagy' attenuates the sensitivity of HCC cells to chemotherapeutic agents.
Pirarubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Pirarubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
PLC cells Liver Homo sapiens (Human) CVCL_0485
L02 cells Liver Homo sapiens (Human) CVCL_6926
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR6825-5p, miR6845-5p and miR6886-3p could decrease the level of USP22 protein by binding to the 3'-untranlated region of USP22 mRNA. All the three microRNAs (miRNAs) were downregulated by HULC, which resulted in the elevation of USP22. The pathway 'HULC/USP22/Sirt1/ protective autophagy' attenuates the sensitivity of HCC cells to chemotherapeutic agents.
References
Ref 1 LncRNA HULC triggers autophagy via stabilizing Sirt1 and attenuates the chemosensitivity of HCC cells. Oncogene. 2017 Jun 22;36(25):3528-3540. doi: 10.1038/onc.2016.521. Epub 2017 Feb 6.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.