Molecule Information

General Information of the Molecule (ID: Mol01714)

• Name: hsa-miR-296-3p ,Homo sapiens
• Synonyms: microRNA 296
• Molecule Type: Mature miRNA
• Sequence: GAGGGUUGGGUGGAGGCUCUCC
• Ensembl ID: ENSG00000284040
• HGNC ID: HGNC:31617
• Mature Accession: MIMAT0004679

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung cancer [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: H157 cells; Lung; Homo sapiens (Human); CVCL_2458
• In Vitro Model: D6 cells; Lung; Homo sapiens (Human); N.A.
• In Vitro Model: LAX cells; Lung; Homo sapiens (Human); N.A.
• In Vitro Model: LTEP-2 cells; Lung; Homo sapiens (Human); CVCL_6929
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR296-3p inhibited NSCLC cell proliferation, enhance the drug resistance, and apoptosis. Data of luciferase reporter assays demonstrated that the CX3CR1 gene was a direct regulator of tumorsuppressive miR296-3p. Moreover, overexpressed CX3CR1 was confirmed in NSCLC clinical specimens. Inhibition of CX3CR1 could inhibit cancer cellular survival and increase chemotherapy sensitivity. There was a negative relationship between miR296-3p and CX3CR1 expression in NSCLC tissues.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [2]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U251AR cells; Brain; Homo sapiens (Human); CVCL_1G29
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: EAG1 channel might be involved in cell-cycle progression of tumour cells because a significant reduction in the proliferation of tumour cell lines could be achieved by inhibiting EAG1 expression using antisense oligonucleotides. Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung cancer [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: H157 cells; Lung; Homo sapiens (Human); CVCL_2458
• In Vitro Model: D6 cells; Lung; Homo sapiens (Human); N.A.
• In Vitro Model: LAX cells; Lung; Homo sapiens (Human); N.A.
• In Vitro Model: LTEP-2 cells; Lung; Homo sapiens (Human); CVCL_6929
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR296-3p inhibited NSCLC cell proliferation, enhance the drug resistance, and apoptosis. Data of luciferase reporter assays demonstrated that the CX3CR1 gene was a direct regulator of tumorsuppressive miR296-3p. Moreover, overexpressed CX3CR1 was confirmed in NSCLC clinical specimens. Inhibition of CX3CR1 could inhibit cancer cellular survival and increase chemotherapy sensitivity. There was a negative relationship between miR296-3p and CX3CR1 expression in NSCLC tissues.

Imatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [2]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U251AR cells; Brain; Homo sapiens (Human); CVCL_1G29
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: EAG1 channel might be involved in cell-cycle progression of tumour cells because a significant reduction in the proliferation of tumour cell lines could be achieved by inhibiting EAG1 expression using antisense oligonucleotides. Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung cancer [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: H157 cells; Lung; Homo sapiens (Human); CVCL_2458
• In Vitro Model: D6 cells; Lung; Homo sapiens (Human); N.A.
• In Vitro Model: LAX cells; Lung; Homo sapiens (Human); N.A.
• In Vitro Model: LTEP-2 cells; Lung; Homo sapiens (Human); CVCL_6929
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR296-3p inhibited NSCLC cell proliferation, enhance the drug resistance, and apoptosis. Data of luciferase reporter assays demonstrated that the CX3CR1 gene was a direct regulator of tumorsuppressive miR296-3p. Moreover, overexpressed CX3CR1 was confirmed in NSCLC clinical specimens. Inhibition of CX3CR1 could inhibit cancer cellular survival and increase chemotherapy sensitivity. There was a negative relationship between miR296-3p and CX3CR1 expression in NSCLC tissues.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [2]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U251AR cells; Brain; Homo sapiens (Human); CVCL_1G29
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: EAG1 channel might be involved in cell-cycle progression of tumour cells because a significant reduction in the proliferation of tumour cell lines could be achieved by inhibiting EAG1 expression using antisense oligonucleotides. Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance.

References

• Ref 1: miRNA-296-3p modulates chemosensitivity of lung cancer cells by targeting CX3CR1. Am J Transl Res. 2016 Apr 15;8(4):1848-56. eCollection 2016.
• Ref 2: MiR-296-3p regulates cell growth and multi-drug resistance of human glioblastoma by targeting ether-a-go-go (EAG1). Eur J Cancer. 2013 Feb;49(3):710-24. doi: 10.1016/j.ejca.2012.08.020. Epub 2012 Sep 18.