Molecule Information

General Information of the Molecule (ID: Mol01701)

• Name: hsa-miR-675-5p ,Homo sapiens
• Synonyms: microRNA 675
• Molecule Type: Mature miRNA
• Sequence: UGGUGCGGAGAGGGCCCACAGUG
• Ensembl ID: ENSG00000284010
• HGNC ID: HGNC:33351
• Mature Accession: MIMAT0004284

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Calcitriol

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Calcitriol
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Inhibition; hsa04310
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: H19 overexpression induces resistance to 1,25(OH)2D3 by inhibiting the expression of VDR Through miR675-5p in colon cancer cells. vdr signaling was able to attenuate the proliferation and migration of colon cancer cells via multiple mechanisms including inhibiting Wnt/beta-catenin pathway, VDR signaling inhibits the expression of h19 by regulating the C-Myc/mad-1 Network.

Investigative Drug(s) 1 drug(s) in total

Huaier extract

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Huaier extract
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: LncRH19/MiR675-5p signaling pathway; Regulation; hsa05206
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Flow cytometry assay; MTT assay
• Mechanism Description: miR675-5p was identified as a mature product of H19. The overexpression of H19 or miR675-5p reverses the tumor-inhibitory effects of Huaier extract. However, knocking down H19 or miR675-5p sensitizes breast cancer cells to Huaier extract. Huaier extract inhibits breast cancer cell proliferation and induces apoptosis via the LncRNA H19/miR675-5p/CBL signaling pathway.

References

• Ref 1: H19 Overexpression Induces Resistance to 1,25(OH)2D3 by Targeting VDR Through miR-675-5p in Colon Cancer Cells. Neoplasia. 2017 Mar;19(3):226-236. doi: 10.1016/j.neo.2016.10.007. Epub 2017 Feb 8.
• Ref 2: Huaier Extract Inhibits Breast Cancer Progression Through a LncRNA-H19/MiR-675-5p Pathway. Cell Physiol Biochem. 2017;44(2):581-593. doi: 10.1159/000485093. Epub 2017 Nov 17.