Molecule Information

General Information of the Molecule (ID: Mol01690)

• Name: hsa-miR-662 ,Homo sapiens
• Synonyms: microRNA 662
• Molecule Type: Mature miRNA
• Sequence: UCCCACGUUGUGGCCCAGCAG
• Ensembl ID: ENSG00000207579
• HGNC ID: HGNC:32918
• Mature Accession: MIMAT0003325

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung squamous cell carcinoma [1]

• Sensitive Disease: Lung squamous cell carcinoma [ICD-11: 2C25.3]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: H1703 cells; Lung; Homo sapiens (Human); CVCL_1490
• In Vitro Model: NCI-H520 cells; Lung; Homo sapiens (Human); CVCL_1566
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-192 and miR-662 enhance chemoresistance and invasiveness of squamous cell lung carcinoma.

References

• Ref 1: MiR-192 and miR-662 enhance chemoresistance and invasiveness of squamous cell lung carcinoma. Lung Cancer. 2018 Apr;118:111-118. doi: 10.1016/j.lungcan.2018.02.002. Epub 2018 Feb 6.