Molecule Information

General Information of the Molecule (ID: Mol01684)

• Name: hsa-miR-634 ,Homo sapiens
• Synonyms: microRNA 634
• Molecule Type: Mature miRNA
• Sequence: AACCAGCACCCCAACUUUGGAC
• Ensembl ID: ENSG00000207943
• HGNC ID: HGNC:32890
• Mature Accession: MIMAT0003304

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Carboplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: MAPK/RAS signaling pathway; Regulation; hsa04010
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-634 is an important player in cisplatin-resistance. First of all, miR-634 was the only miR miR-634 overexpression in ovarian cancer cell lines and patient samples negatively regulates important cell-cycle genes (CCND1) and Ras-MAPk pathway components (GRB2, ERk2, RSk1 and RSk2). Inhibition of the Ras-MAPk pathway resulted in increased sensitivity to cisplatin, suggesting that the miR-634-mediated repression of this pathway is responsible for the effect of miR-634 on cisplatin resistance.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: MAPK/RAS signaling pathway; Regulation; hsa04010
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-634 is an important player in cisplatin-resistance. First of all, miR-634 was the only miR miR-634 overexpression in ovarian cancer cell lines and patient samples negatively regulates important cell-cycle genes (CCND1) and Ras-MAPk pathway components (GRB2, ERk2, RSk1 and RSk2). Inhibition of the Ras-MAPk pathway resulted in increased sensitivity to cisplatin, suggesting that the miR-634-mediated repression of this pathway is responsible for the effect of miR-634 on cisplatin resistance.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: MAPK/RAS signaling pathway; Regulation; hsa04010
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-634 is an important player in cisplatin-resistance. First of all, miR-634 was the only miR miR-634 overexpression in ovarian cancer cell lines and patient samples negatively regulates important cell-cycle genes (CCND1) and Ras-MAPk pathway components (GRB2, ERk2, RSk1 and RSk2). Inhibition of the Ras-MAPk pathway resulted in increased sensitivity to cisplatin, suggesting that the miR-634-mediated repression of this pathway is responsible for the effect of miR-634 on cisplatin resistance.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [2]

• Sensitive Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: CNE1 cells; Throat; Homo sapiens (Human); CVCL_6888
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-634 most significantly downregulated in the paclitaxel-resistant CNE-1/Taxol, in regulating the paclitaxel sensitivity in NPC cells. miR-634 expression in the CNE-1/Taxol cells by lentivirus infection, miR-634 re-sensitized the CNE-1/Taxol cells to paclitaxel in vitro. In xenograft mouse model, miR-634 inhibited tumor growth and (+) paclitaxel sensitivity.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [3]

• Resistant Disease: Glioma [ICD-11: 2A00.1]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: RAF/ERK signaling pathway; Activation; hsa04010
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Overexpression of CYR61 increased the survival rate of U251/TMZ and U87/TMZ cells after TMZ treatment, while induction of miR-634 significantly suppressed the survival of U251/TMZ and U87/TMZ cells after TMZ treatment.

References

• Ref 1: miR-634 restores drug sensitivity in resistant ovarian cancer cells by targeting the Ras-MAPK pathway. Mol Cancer. 2015 Nov 17;14:196. doi: 10.1186/s12943-015-0464-4.
• Ref 2: MiR-634 sensitizes nasopharyngeal carcinoma cells to paclitaxel and inhibits cell growth both in vitro and in vivo. Int J Clin Exp Pathol. 2014 Sep 15;7(10):6784-91. eCollection 2014.
• Ref 3: MiR-634 sensitizes glioma cells to temozolomide by targeting CYR61 through Raf-ERK signaling pathway. Cancer Med. 2018 Mar;7(3):913-921. doi: 10.1002/cam4.1351. Epub 2018 Feb 23.