Molecule Information

General Information of the Molecule (ID: Mol01661)

• Name: hsa-miR-193b-3p ,Homo sapiens
• Synonyms: microRNA 193b
• Molecule Type: Mature miRNA
• Sequence: AACUGGCCCUCAAAGUCCCGCU
• Ensembl ID: ENSG00000207639
• HGNC ID: HGNC:32087
• Mature Accession: MIMAT0002819

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Alamar Blue assay
• Mechanism Description: 2 platinum-associated miRNAs (miR-193b* and miR-320) that inhibit the expression of five platinum-associated genes (CRIM1, IFIT2, OAS1, kCNMA1 and GRAMD1B). over-expression of miR-193b* in a randomly selected HapMap cell line results in resistance to both carboplatin and cisplatin.

References

• Ref 1: Genetic variation that predicts platinum sensitivity reveals the role of miR-193b* in chemotherapeutic susceptibility. Mol Cancer Ther. 2012 Sep;11(9):2054-61. doi: 10.1158/1535-7163.MCT-12-0221. Epub 2012 Jun 29.